From 4fde1e8ccbd2fb19556f801cdcbe0e1b21650b18 Mon Sep 17 00:00:00 2001 From: Vincent St-Amour Date: Thu, 10 Jun 2010 16:50:43 -0400 Subject: [PATCH] Ported most of the shootout benchmarks to Typed Scheme. --- collects/meta/props | 35 +++ .../typed/ackermann-non-optimizing.rkt | 2 + .../shootout/typed/ackermann-optimizing.rkt | 2 + .../benchmarks/shootout/typed/ackermann.rktl | 12 ++ .../shootout/typed/ary-non-optimizing.rkt | 2 + .../shootout/typed/ary-optimizing.rkt | 2 + .../racket/benchmarks/shootout/typed/ary.rktl | 23 ++ .../racket/benchmarks/shootout/typed/auto.rkt | 202 ++++++++++++++++++ .../typed/chameneos-non-optimizing.rkt | 2 + .../shootout/typed/chameneos-optimizing.rkt | 2 + .../benchmarks/shootout/typed/chameneos.rktl | 108 ++++++++++ .../typed/cheapconcurrency-non-optimizing.rkt | 2 + .../typed/cheapconcurrency-optimizing.rkt | 2 + .../shootout/typed/cheapconcurrency.rktl | 23 ++ .../shootout/typed/echo-non-optimizing.rkt | 2 + .../shootout/typed/echo-optimizing.rkt | 2 + .../benchmarks/shootout/typed/echo.rktl | 49 +++++ .../shootout/typed/except-non-optimizing.rkt | 2 + .../shootout/typed/except-optimizing.rkt | 2 + .../benchmarks/shootout/typed/except.rktl | 44 ++++ .../typed/fannkuch-non-optimizing.rkt | 2 + .../shootout/typed/fannkuch-optimizing.rkt | 2 + .../benchmarks/shootout/typed/fannkuch.rktl | 69 ++++++ .../shootout/typed/fasta-non-optimizing.rkt | 2 + .../shootout/typed/fasta-optimizing.rkt | 2 + .../benchmarks/shootout/typed/fasta.rktl | 115 ++++++++++ .../shootout/typed/fibo-non-optimizing.rkt | 2 + .../shootout/typed/fibo-optimizing.rkt | 2 + .../benchmarks/shootout/typed/fibo.rktl | 14 ++ .../shootout/typed/hash-non-optimizing.rkt | 2 + .../shootout/typed/hash-optimizing.rkt | 2 + .../benchmarks/shootout/typed/hash.rktl | 18 ++ .../shootout/typed/hash2-non-optimizing.rkt | 2 + .../shootout/typed/hash2-optimizing.rkt | 2 + .../benchmarks/shootout/typed/hash2.rktl | 25 +++ .../typed/heapsort-non-optimizing.rkt | 2 + .../shootout/typed/heapsort-optimizing.rkt | 2 + .../benchmarks/shootout/typed/heapsort.rktl | 72 +++++++ .../typed/mandelbrot-non-optimizing.rkt | 2 + .../shootout/typed/mandelbrot-optimizing.rkt | 2 + .../benchmarks/shootout/typed/mandelbrot.rktl | 68 ++++++ .../shootout/typed/matrix-non-optimizing.rkt | 2 + .../shootout/typed/matrix-optimizing.rkt | 2 + .../benchmarks/shootout/typed/matrix.rktl | 92 ++++++++ .../shootout/typed/moments-non-optimizing.rkt | 2 + .../shootout/typed/moments-optimizing.rkt | 2 + .../benchmarks/shootout/typed/moments.rktl | 72 +++++++ .../shootout/typed/nbody-non-optimizing.rkt | 2 + .../shootout/typed/nbody-optimizing.rkt | 2 + .../benchmarks/shootout/typed/nbody.rktl | 161 ++++++++++++++ .../typed/nestedloop-non-optimizing.rkt | 2 + .../shootout/typed/nestedloop-optimizing.rkt | 2 + .../benchmarks/shootout/typed/nestedloop.rktl | 18 ++ .../shootout/typed/nsieve-non-optimizing.rkt | 2 + .../shootout/typed/nsieve-optimizing.rkt | 2 + .../benchmarks/shootout/typed/nsieve.rktl | 46 ++++ .../typed/nsievebits-non-optimizing.rkt | 2 + .../shootout/typed/nsievebits-optimizing.rkt | 2 + .../benchmarks/shootout/typed/nsievebits.rktl | 74 +++++++ .../typed/partialsums-non-optimizing.rkt | 2 + .../shootout/typed/partialsums-optimizing.rkt | 2 + .../shootout/typed/partialsums.rktl | 57 +++++ .../typed/pidigits-non-optimizing.rkt | 2 + .../shootout/typed/pidigits-optimizing.rkt | 2 + .../benchmarks/shootout/typed/pidigits.rktl | 55 +++++ .../typed/pidigits1-non-optimizing.rkt | 2 + .../shootout/typed/pidigits1-optimizing.rkt | 2 + .../benchmarks/shootout/typed/pidigits1.rktl | 58 +++++ .../shootout/typed/random-non-optimizing.rkt | 2 + .../shootout/typed/random-optimizing.rkt | 2 + .../benchmarks/shootout/typed/random.rktl | 39 ++++ .../typed/recursive-non-optimizing.rkt | 2 + .../shootout/typed/recursive-optimizing.rkt | 2 + .../benchmarks/shootout/typed/recursive.rktl | 64 ++++++ .../typed/regexpdna-non-optimizing.rkt | 2 + .../shootout/typed/regexpdna-optimizing.rkt | 2 + .../benchmarks/shootout/typed/regexpdna.rktl | 57 +++++ .../reversecomplement-non-optimizing.rkt | 2 + .../typed/reversecomplement-optimizing.rkt | 2 + .../shootout/typed/reversecomplement.rktl | 60 ++++++ .../typed/reversefile-non-optimizing.rkt | 2 + .../shootout/typed/reversefile-optimizing.rkt | 2 + .../shootout/typed/reversefile.rktl | 12 ++ .../racket/benchmarks/shootout/typed/run.rkt | 128 +++++++++++ .../shootout/typed/sieve-non-optimizing.rkt | 2 + .../shootout/typed/sieve-optimizing.rkt | 2 + .../benchmarks/shootout/typed/sieve.rktl | 27 +++ .../typed/spectralnorm-non-optimizing.rkt | 2 + .../typed/spectralnorm-optimizing.rkt | 2 + .../shootout/typed/spectralnorm.rktl | 65 ++++++ .../typed/spellcheck-non-optimizing.rkt | 2 + .../shootout/typed/spellcheck-optimizing.rkt | 2 + .../benchmarks/shootout/typed/spellcheck.rktl | 23 ++ .../shootout/typed/strcat-non-optimizing.rkt | 2 + .../shootout/typed/strcat-optimizing.rkt | 2 + .../benchmarks/shootout/typed/strcat.rktl | 37 ++++ .../shootout/typed/sumcol-non-optimizing.rkt | 2 + .../shootout/typed/sumcol-optimizing.rkt | 2 + .../benchmarks/shootout/typed/sumcol.rktl | 4 + .../shootout/typed/wc-non-optimizing.rkt | 2 + .../shootout/typed/wc-optimizing.rkt | 2 + .../racket/benchmarks/shootout/typed/wc.rktl | 22 ++ .../typed/wordfreq-non-optimizing.rkt | 2 + .../shootout/typed/wordfreq-optimizing.rkt | 2 + .../benchmarks/shootout/typed/wordfreq.rktl | 35 +++ .../typed/wrap-typed-non-optimizing.rkt | 15 ++ .../shootout/typed/wrap-typed-optimizing.rkt | 15 ++ 107 files changed, 2249 insertions(+) create mode 100644 collects/tests/racket/benchmarks/shootout/typed/ackermann-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/ackermann-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/ackermann.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/ary-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/ary-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/ary.rktl create mode 100755 collects/tests/racket/benchmarks/shootout/typed/auto.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/chameneos-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/chameneos-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/chameneos.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/echo-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/echo-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/echo.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/except-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/except-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/except.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/fannkuch-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/fannkuch-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/fannkuch.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/fasta-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/fasta-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/fasta.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/fibo-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/fibo-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/fibo.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/hash-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/hash-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/hash.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/hash2-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/hash2-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/hash2.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/heapsort-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/heapsort-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/heapsort.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/mandelbrot-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/mandelbrot-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/mandelbrot.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/matrix-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/matrix-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/matrix.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/moments-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/moments-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/moments.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nbody-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nbody-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nbody.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nestedloop-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nestedloop-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nestedloop.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nsieve-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nsieve-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nsieve.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nsievebits-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nsievebits-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/nsievebits.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/partialsums-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/partialsums-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/partialsums.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/pidigits-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/pidigits-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/pidigits.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/pidigits1-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/pidigits1-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/pidigits1.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/random-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/random-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/random.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/recursive-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/recursive-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/recursive.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/regexpdna-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/regexpdna-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/regexpdna.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/reversecomplement-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/reversecomplement-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/reversecomplement.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/reversefile-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/reversefile-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/reversefile.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/run.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/sieve-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/sieve-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/sieve.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/spectralnorm-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/spectralnorm-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/spectralnorm.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/spellcheck-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/spellcheck-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/spellcheck.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/strcat-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/strcat-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/strcat.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/sumcol-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/sumcol-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/sumcol.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/wc-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/wc-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/wc.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/wordfreq-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/wordfreq-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/wordfreq.rktl create mode 100644 collects/tests/racket/benchmarks/shootout/typed/wrap-typed-non-optimizing.rkt create mode 100644 collects/tests/racket/benchmarks/shootout/typed/wrap-typed-optimizing.rkt diff --git a/collects/meta/props b/collects/meta/props index 3e2b703c24..3f942dc167 100755 --- a/collects/meta/props +++ b/collects/meta/props @@ -1540,6 +1540,41 @@ path/s is either such a string or a list of them. "collects/tests/racket/benchmarks/shootout/spellcheck.rkt" drdr:command-line (mzc *) "collects/tests/racket/benchmarks/shootout/strcat.rkt" drdr:command-line (racket "-t" * "--" "25") "collects/tests/racket/benchmarks/shootout/thread-ring.rkt" drdr:command-line (racket "-t" * "--" "25") +"collects/tests/racket/benchmarks/shootout/typed" responsible (stamourv) +"collects/tests/racket/benchmarks/shootout/typed/ackermann.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/ary.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/chameneos.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/echo.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/except.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/fannkuch.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/fasta.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/fibo.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/hash.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/hash2.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/heapsort.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/mandelbrot.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/matrix.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/moments.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/nbody.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/nestedloop.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/nsieve.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/nsievebits.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/partialsums.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/pidigits.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/pidigits1.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/random.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/recursive.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/regexpdna.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/reversecomplement.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/reversefile.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/sieve.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/spectralnorm.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/spellcheck.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/strcat.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/sumcol.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/wc.rktl" drdr:command-line #f +"collects/tests/racket/benchmarks/shootout/typed/wordfreq.rktl" drdr:command-line #f "collects/tests/racket/binc.rktl" drdr:command-line #f "collects/tests/racket/boundmap-test.rktl" drdr:command-line (racket "-f" *) "collects/tests/racket/cache-image-snip-test.rktl" drdr:command-line (gracket "-f" *) diff --git a/collects/tests/racket/benchmarks/shootout/typed/ackermann-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/ackermann-non-optimizing.rkt new file mode 100644 index 0000000000..e4723b3e92 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/ackermann-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module ackermann-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/ackermann-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/ackermann-optimizing.rkt new file mode 100644 index 0000000000..8416b421c5 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/ackermann-optimizing.rkt @@ -0,0 +1,2 @@ + +(module ackermann-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/ackermann.rktl b/collects/tests/racket/benchmarks/shootout/typed/ackermann.rktl new file mode 100644 index 0000000000..e0d5035096 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/ackermann.rktl @@ -0,0 +1,12 @@ +(require scheme/cmdline) + +(: ack (Integer Integer -> Integer)) +(define (ack m n) + (cond ((zero? m) (+ n 1)) + ((zero? n) (ack (- m 1) 1)) + (else (ack (- m 1) (ack m (- n 1)))))) + +(command-line #:args (n) + (printf "Ack(3,~a): ~a~n" + n + (ack 3 (assert (string->number (assert n string?)) exact-integer?)))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/ary-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/ary-non-optimizing.rkt new file mode 100644 index 0000000000..577d4f8932 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/ary-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module ary-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/ary-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/ary-optimizing.rkt new file mode 100644 index 0000000000..2da4d64ea3 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/ary-optimizing.rkt @@ -0,0 +1,2 @@ + +(module ary-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/ary.rktl b/collects/tests/racket/benchmarks/shootout/typed/ary.rktl new file mode 100644 index 0000000000..1ae032dee9 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/ary.rktl @@ -0,0 +1,23 @@ +(: main ((Vectorof String) -> Void)) +(define (main args) + (let*: ((n : Exact-Positive-Integer + (if (= (vector-length args) 0) + 1 + (assert (string->number (vector-ref args 0)) exact-positive-integer?))) + (x : (Vectorof Integer) (make-vector n 0)) + (y : (Vectorof Integer) (make-vector n 0)) + (last : Natural (- n 1))) + (do ((i 0 (+ i 1))) + ((= i n)) + (vector-set! x i (+ i 1))) + (do ((k 0 (+ k 1))) + ((= k 1000)) + (do: : Void ((i : Integer last (- i 1))) + ((< i 0)) + (vector-set! y i (+ (vector-ref x i) (vector-ref y i))))) + (print-list (vector-ref y 0) " " (vector-ref y last)))) + +(: print-list (Any * -> Void)) +(define (print-list . items) (for-each display items) (newline)) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/auto.rkt b/collects/tests/racket/benchmarks/shootout/typed/auto.rkt new file mode 100755 index 0000000000..8724475ed2 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/auto.rkt @@ -0,0 +1,202 @@ +#!/bin/sh +#| +exec racket -qu "$0" ${1+"$@"} +|# + +;; Benchmark harness for the shootout benchmarks +;; Mostly taken from the common benchmark harness + +(module auto scheme/base + (require (for-syntax scheme/base) + mzlib/process + "../../common/cmdline.rkt" + mzlib/list + mzlib/compile + mzlib/inflate + mzlib/date + mzlib/port + mzlib/file + dynext/file + syntax/toplevel + scheme/runtime-path) + + ;; Implementaton-specific control functions ------------------------------ + + (define (bytes->number b) + (string->number (bytes->string/latin-1 b))) + + (define ((run-mk script) bm) + (when (file-exists? (symbol->string bm)) + (delete-file (symbol->string bm))) + (parameterize ([current-command-line-arguments (vector (symbol->string bm))]) + (namespace-require 'scheme) + (load script))) + + (define (mk-racket bm) + (unless (directory-exists? "../compiled") + (make-directory "../compiled")) + (parameterize ([current-namespace (make-base-namespace)] + [read-accept-reader #t]) + (let ([name (format "~a.rkt" bm)]) + (compile-file (format "../~a" name) + (build-path "../compiled" (path-add-suffix name #".zo")))))) + + (define (clean-up-zo bm) + (when (directory-exists? "../compiled") + (delete-directory/files "../compiled"))) + + (define (mk-typed-scheme bm) + (unless (directory-exists? "compiled") + (make-directory "compiled")) + (parameterize ([current-namespace (make-base-namespace)] + [read-accept-reader #t]) + (let ([name (format "~a-non-optimizing.rkt" bm)]) + (compile-file name + (build-path "compiled" (path-add-suffix name #".zo")))))) + (define (mk-typed-scheme-optimizing bm) + (unless (directory-exists? "compiled") + (make-directory "compiled")) + (parameterize ([current-namespace (make-base-namespace)] + [read-accept-reader #t]) + (let ([name (format "~a-optimizing.rkt" bm)]) + (compile-file name + (build-path "compiled" (path-add-suffix name #".zo")))))) + + (define (clean-up-typed bm) + (when (directory-exists? "compiled") + (delete-directory/files "compiled"))) + + (define (extract-racket-times bm str) + (let ([m (regexp-match #rx#"cpu time: ([0-9]+) real time: ([0-9]+) gc time: ([0-9]+)" str)]) + (map bytes->number (cdr m)))) + + ;; Table of implementatons and benchmarks ------------------------------ + + (define-struct impl (name setup make run extract-result clean-up skips)) + + (define untypeable-benchmarks + '(binarytrees + lists + regexmatch + k-nucleotide)) + + (define impls + (list + (make-impl 'racket + void + mk-racket + (lambda (bm) + (system (format "racket run.rkt ~a racket" bm))) + extract-racket-times + clean-up-zo + '()) + (make-impl 'typed-scheme + void + mk-typed-scheme + (lambda (bm) + (system (format "racket run.rkt ~a typed-scheme" bm))) + extract-racket-times + clean-up-typed + untypeable-benchmarks) + (make-impl 'typed-scheme-optimizing + void + mk-typed-scheme-optimizing + (lambda (bm) + (system (format "racket run.rkt ~a typed-scheme-optimizing" bm))) + extract-racket-times + clean-up-typed + untypeable-benchmarks) + )) + + (define benchmarks + '(ackermann + ary + binarytrees + chameneos + cheapconcurrency + echo + except + fannkuch + fasta + fibo + hash + hash2 + heapsort + k-nucleotide + lists + mandelbrot + matrix + moments + nbody + nestedloop + nsieve + nsievebits + partialsums + pidigits + pidigits1 + random + recursive + regexmatch + regexpdna + reversecomplement + reversefile + sieve + spectralnorm + strcat + sumcol + wc + wordfreq)) + + (define without-input-benchmarks + '(spellcheck)) + + (define (run-benchmark impl bm) + (let ([i (ormap (lambda (i) + (and (eq? impl (impl-name i)) + i)) + impls)]) + (if (memq bm (impl-skips i)) + (rprintf "[~a ~a ~s #f]\n" impl bm '(#f #f #f)) + (begin + ((impl-setup i) bm) + (let ([start (current-inexact-milliseconds)]) + ((impl-make i) bm) + (let ([end (current-inexact-milliseconds)]) + (let loop ([n num-iterations]) + (unless (zero? n) + (let ([out (open-output-bytes)]) + (unless (parameterize ([current-output-port out] + [current-error-port out]) + ((impl-run i) bm)) + (error 'auto "~a\nrun failed ~a" (get-output-bytes out) bm)) + (rprintf "[~a ~a ~s ~a]\n" + impl + bm + ((impl-extract-result i) bm (get-output-bytes out)) + (inexact->exact (round (- end start))))) + (loop (sub1 n))))) + ((impl-clean-up i) bm)))) + (flush-output))) + + ;; Extract command-line arguments -------------------- + + (define-values (actual-benchmarks-to-run + actual-implementations-to-run + num-iterations) + (process-command-line benchmarks + '() + (map impl-name impls) '() ; no obsolete implementations here + 3)) + + (define-runtime-path bm-directory ".") + + ;; Run benchmarks ------------------------------- + + #;(rprintf "; ~a\n" (date->string (seconds->date (current-seconds)) #t)) + + (parameterize ([current-directory bm-directory]) + (for-each (lambda (impl) + (map (lambda (bm) + (run-benchmark impl bm)) + actual-benchmarks-to-run)) + actual-implementations-to-run))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/chameneos-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/chameneos-non-optimizing.rkt new file mode 100644 index 0000000000..807321c681 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/chameneos-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module chameneos-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/chameneos-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/chameneos-optimizing.rkt new file mode 100644 index 0000000000..d7c0cc8d81 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/chameneos-optimizing.rkt @@ -0,0 +1,2 @@ + +(module chameneos-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/chameneos.rktl b/collects/tests/racket/benchmarks/shootout/typed/chameneos.rktl new file mode 100644 index 0000000000..cdbc09e894 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/chameneos.rktl @@ -0,0 +1,108 @@ +;;; The Great Computer Language Shootout +;;; http://shootout.alioth.debian.org/ +;;; +;;; Uses Racket threads + +(require racket/cmdline + racket/match) + +(define-type Color (U 'red 'yellow 'blue)) +(define-type MeetingChannel (Channelof (Pair (Channelof (Option (Pair Color Symbol))) + (Pair Color Symbol)))) +(define-type ResultChannel (Channelof (Pair Integer Integer))) + +(: change (Color Color -> Color)) +(define (change c1 c2) + (case c1 + [(red) + (case c2 [(blue) 'yellow] [(yellow) 'blue] [else c1])] + [(yellow) + (case c2 [(blue) 'red] [(red) 'blue] [else c1])] + [(blue) + (case c2 [(yellow) 'red] [(red) 'yellow] [else c1])])) + +(let ([colors '(blue red yellow)]) + (for*: ([a : Color colors][b : Color colors]) + (printf "~a + ~a -> ~a\n" a b (change a b)))) + +(: place (MeetingChannel Integer -> Thread)) +(define (place meeting-ch n) + (thread + (lambda () + (let: loop : Void ([n : Integer n]) + (if (zero? n) + ;; Fade all: + (let loop () + (let ([c (channel-get meeting-ch)]) + (channel-put (car c) #f) + (loop))) + ;; Let two meet: + (match-let ([(cons ch1 v1) (channel-get meeting-ch)] + [(cons ch2 v2) (channel-get meeting-ch)]) + (channel-put ch1 v2) + (channel-put ch2 v1) + (loop (sub1 n)))))))) + +(: creature (Color MeetingChannel ResultChannel -> Thread)) +(define (creature color meeting-ch result-ch) + (thread + (lambda () + (let: ([ch : (Channelof (Option (Pair Color Symbol))) (make-channel)] + [name : Symbol (gensym)]) + (let: loop : Void ([color : Color color][met : Integer 0][same : Integer 0]) + (channel-put meeting-ch (cons ch (cons color name))) + (match (channel-get ch) + [(cons other-color other-name) + ;; Meet: + (sleep) ; avoid imbalance from weak fairness + (loop (change color other-color) + (add1 met) + (+ same (if (eq? name other-name) + 1 + 0)))] + [#f + ;; Done: + (channel-put result-ch (cons met same))])))))) + +(: spell (Integer -> Void)) +(define (spell n) + (for: ([i : Char (number->string n)]) + (display " ") + (display (hash-ref digits i)))) + +(define digits + #hash((#\0 . "zero") + (#\1 . "one") + (#\2 . "two") + (#\3 . "three") + (#\4 . "four") + (#\5 . "five") + (#\6 . "six") + (#\7 . "seven") + (#\8 . "eight") + (#\9 . "nine"))) + +(: go (Integer (Listof Color) -> Void)) +(define (go n inits) + (let: ([result-ch : ResultChannel (make-channel)] + [meeting-ch : MeetingChannel (make-channel)]) + (place meeting-ch n) + (newline) + (for ([init inits]) + (printf " ~a" init) + (creature init meeting-ch result-ch)) + (newline) + (let ([results (for/list: : (Listof (Pair Integer Integer)) + ([i : Color inits]) + (channel-get result-ch))]) + (for ([r results]) + (display (car r)) + (spell (cdr r)) + (newline)) + (spell (apply + (map (inst car Integer Integer) results))) + (newline)))) + +(let ([n (command-line #:args (n) (assert (string->number (assert n string?)) exact-integer?))]) + (go n '(blue red yellow)) + (go n '(blue red yellow red yellow blue red yellow red blue)) + (newline)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency-non-optimizing.rkt new file mode 100644 index 0000000000..e465d45f50 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module cheapconcurrency-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency-optimizing.rkt new file mode 100644 index 0000000000..9f60fe1eb8 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency-optimizing.rkt @@ -0,0 +1,2 @@ + +(module cheapconcurrency-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency.rktl b/collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency.rktl new file mode 100644 index 0000000000..d4430a7b84 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/cheapconcurrency.rktl @@ -0,0 +1,23 @@ +(require scheme/cmdline) + +(: generate ((Channelof Natural) Natural -> (Channelof Natural))) +(define (generate receive-ch n) + (if (zero? n) + receive-ch + (let: ([ch : (Channelof Natural) (make-channel)]) + (thread (lambda () + (let: loop : Void () + (channel-put ch (add1 (channel-get receive-ch))) + (loop)))) + (generate ch (sub1 n))))) + +(let ([n (command-line #:args (n) (assert (string->number (assert n string?)) exact-integer?))]) + (let*: ([start-ch : (Channelof Natural) (make-channel)] + [end-ch : (Channelof Natural) (generate start-ch 500)]) + (let: loop : Void ([n : Integer n][total : Integer 0]) + (if (zero? n) + (printf "~a\n" total) + (begin + (channel-put start-ch 0) + (loop (sub1 n) + (+ total (channel-get end-ch)))))))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/echo-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/echo-non-optimizing.rkt new file mode 100644 index 0000000000..9ea203c1ba --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/echo-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module echo-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/echo-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/echo-optimizing.rkt new file mode 100644 index 0000000000..b404878fec --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/echo-optimizing.rkt @@ -0,0 +1,2 @@ + +(module echo-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/echo.rktl b/collects/tests/racket/benchmarks/shootout/typed/echo.rktl new file mode 100644 index 0000000000..fb0e52fdb2 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/echo.rktl @@ -0,0 +1,49 @@ +(require racket/tcp) + +(define PORT 8888) +(define DATA "Hello there sailor\n") +(define n 10) + +(: server ( -> Void)) +(define (server) + (thread client) + (let-values ([(in out) (tcp-accept (tcp-listen PORT 5 #t))] + [(buffer) (make-string (string-length DATA))]) + (file-stream-buffer-mode out 'none) + (let: loop : Void ([i : (U Integer EOF) (read-string! buffer in)] + [bytes : Integer 0]) + (if (not (eof-object? i)) + (begin + (display buffer out) + (loop (read-string! buffer in) + (+ bytes (string-length buffer)))) + (begin + (display "server processed ") + (display bytes) + (display " bytes\n")))))) + +(: client ( -> (U Void 'error))) +(define (client) + (let-values ([(in out) (tcp-connect "127.0.0.1" PORT)] + [(buffer) (make-string (string-length DATA))]) + (file-stream-buffer-mode out 'none) + (let: loop : (U Void 'error) ([n : Integer n]) + (if (> n 0) + (begin + (display DATA out) + (let ([i (read-string! buffer in)]) + (begin + (if (equal? DATA buffer) + (loop (- n 1)) + 'error)))) + (close-output-port out))))) + +(: main ((Vectorof String) -> Void)) +(define (main args) + (set! n + (if (= (vector-length args) 0) + 1 + (assert (string->number (vector-ref args 0)) exact-positive-integer?))) + (server)) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/except-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/except-non-optimizing.rkt new file mode 100644 index 0000000000..5dee630c6f --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/except-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module except-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/except-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/except-optimizing.rkt new file mode 100644 index 0000000000..1c97f5b8a3 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/except-optimizing.rkt @@ -0,0 +1,2 @@ + +(module except-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/except.rktl b/collects/tests/racket/benchmarks/shootout/typed/except.rktl new file mode 100644 index 0000000000..4d4b2aba6a --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/except.rktl @@ -0,0 +1,44 @@ +(: HI Integer) +(define HI 0) +(: LO Integer) +(define LO 0) + +(define (hi-excp? x) (eq? x 'Hi_Exception)) +(define (lo-excp? x) (eq? x 'Lo_Exception)) +(define (true? x) (if (boolean? x) x #t)) + +(: some_fun (Integer -> Any)) +(define (some_fun n) + (with-handlers + ([true? (lambda (exn) #f)]) + (hi_fun n))) + +(: hi_fun (Integer -> Any)) +(define (hi_fun n) + (with-handlers + ([hi-excp? (lambda (exn) (set! HI (+ HI 1))) ]) + (lo_fun n))) + +(: lo_fun (Integer -> Any)) +(define (lo_fun n) + (with-handlers + ([lo-excp? (lambda (exn) (set! LO (+ LO 1))) ]) + (blowup n))) + +(: blowup (Integer -> Any)) +(define (blowup n) + (if (= 0 (modulo n 2)) + (raise 'Hi_Exception) + (raise 'Lo_Exception))) + +(: main ((Vectorof String) -> Void)) +(define (main args) + (let* ((n (if (= (vector-length args) 1) + (assert (string->number (vector-ref args 0)) exact-integer?) + 1))) + (do ((i 0 (+ i 1))) + ((= i n)) + (some_fun i))) + (printf "Exceptions: HI=~a / LO=~a~n" HI LO)) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/fannkuch-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/fannkuch-non-optimizing.rkt new file mode 100644 index 0000000000..4dd6b2947b --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/fannkuch-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module fannkuch-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/fannkuch-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/fannkuch-optimizing.rkt new file mode 100644 index 0000000000..97ac503701 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/fannkuch-optimizing.rkt @@ -0,0 +1,2 @@ + +(module fannkuch-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/fannkuch.rktl b/collects/tests/racket/benchmarks/shootout/typed/fannkuch.rktl new file mode 100644 index 0000000000..d19d890b77 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/fannkuch.rktl @@ -0,0 +1,69 @@ +;; fannkuch benchmark for The Computer Language Shootout +;; Written by Dima Dorfman, 2004 +;; Slightly improved by Sven Hartrumpf, 2005-2006 +;; Ever-so-slightly tweaked for MzScheme by Brent Fulgham +;; PLT-ized for v4.0 by Matthew +;; Ported to Typed Scheme by Vincent + +(require racket/cmdline) + +(: fannkuch (Natural -> Natural)) +(define (fannkuch n) + (let ([pi (list->vector + (for/list: : (Listof Natural) ([i : Natural (in-range n)]) i))] + [tmp (make-vector n)] + [count (make-vector n)]) + (let: loop : Natural + ([flips : Natural 0] + [perms : Natural 0] + [r : Natural n]) + (when (< perms 30) + (for ([x (in-vector pi)]) + (display (add1 x))) + (newline)) + (for ([i (in-range r)]) + (vector-set! count i (add1 i))) + (let ((flips2 (max (count-flips pi tmp) flips))) + (let loop2 ([r 1]) + (if (= r n) + flips2 + (let ((perm0 (vector-ref pi 0))) + (for ([i (in-range r)]) + (vector-set! pi i (vector-ref pi (add1 i)))) + (vector-set! pi r perm0) + (vector-set! count r (assert (sub1 (vector-ref count r)) exact-nonnegative-integer?)) + (cond + [(<= (vector-ref count r) 0) + (loop2 (add1 r))] + [else (loop flips2 (add1 perms) r)])))))))) + +(: count-flips ((Vectorof Natural) (Vectorof Natural) -> Natural)) +(define (count-flips pi rho) + (vector-copy! rho 0 pi) + (let: loop : Natural ([i : Natural 0]) + (if (= (vector-ref rho 0) 0) + i + (begin + (vector-reverse-slice! rho 0 (add1 (vector-ref rho 0))) + (loop (add1 i)))))) + +(: vector-reverse-slice! (All (X) ((Vectorof X) Natural Natural -> Void))) +(define (vector-reverse-slice! v i j) + (let: loop : Void + ([i : Natural i] + [j : Natural (assert (sub1 j) exact-nonnegative-integer?)]) + (when (> j i) + (vector-swap! v i j) + (loop (assert (add1 i) exact-nonnegative-integer?) + (assert (sub1 j) exact-nonnegative-integer?))))) + +(: vector-swap! (All (X) ((Vectorof X) Natural Natural -> Void))) +(define (vector-swap! v i j) + (let ((t (vector-ref v i))) + (vector-set! v i (vector-ref v j)) + (vector-set! v j t))) + +(command-line #:args (n) + (printf "Pfannkuchen(~a) = ~a\n" + n + (fannkuch (assert (string->number (assert n string?)) exact-nonnegative-integer?)))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/fasta-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/fasta-non-optimizing.rkt new file mode 100644 index 0000000000..1381f601c6 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/fasta-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module fasta-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/fasta-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/fasta-optimizing.rkt new file mode 100644 index 0000000000..ebed6a6670 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/fasta-optimizing.rkt @@ -0,0 +1,2 @@ + +(module fasta-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/fasta.rktl b/collects/tests/racket/benchmarks/shootout/typed/fasta.rktl new file mode 100644 index 0000000000..821790c9c3 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/fasta.rktl @@ -0,0 +1,115 @@ +;; The Great Computer Language Shootout +;; http://shootout.alioth.debian.org/ +;; +;; fasta - benchmark +;; +;; Derived from the Chicken variant, which was +;; Contributed by Anthony Borla + +(require racket/cmdline) + +(define-type CumulativeTable (Listof (Pair Natural Float))) + +(define +alu+ + (bytes-append + #"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + #"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + #"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + #"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + #"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + #"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + #"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")) + +(define +iub+ + (list + '(#\a . 0.27) '(#\c . 0.12) '(#\g . 0.12) '(#\t . 0.27) '(#\B . 0.02) + '(#\D . 0.02) '(#\H . 0.02) '(#\K . 0.02) '(#\M . 0.02) '(#\N . 0.02) + '(#\R . 0.02) '(#\S . 0.02) '(#\V . 0.02) '(#\W . 0.02) '(#\Y . 0.02))) + +(define +homosapien+ + (list + '(#\a . 0.3029549426680) '(#\c . 0.1979883004921) + '(#\g . 0.1975473066391) '(#\t . 0.3015094502008))) + +;; ------------- + +(define +line-size+ 60) + +;; ------------------------------- + +(: make-random (Integer -> (Real -> Real))) +(define (make-random seed) + (let* ((ia 3877) (ic 29573) (im 139968) (last seed)) + (lambda: ((max : Real)) + (set! last (modulo (+ ic (* last ia)) im)) + (/ (* max last) im)))) + +;; ------------------------------- + +(: make-cumulative-table ((Listof (Pair Char Float)) -> CumulativeTable)) +(define (make-cumulative-table frequency-table) + (let ([cumulative 0.0]) + (for/list: : CumulativeTable + ([x : (Pair Char Float) frequency-table]) + (set! cumulative (+ cumulative (cdr x))) + (cons (char->integer (car x)) cumulative)))) + +;; ------------- + +(define random-next (make-random 42)) +(define +segmarker+ ">") + +;; ------------- + +(: select-random (CumulativeTable -> Natural)) +(define (select-random cumulative-table) + (let ((rvalue (random-next 1.0))) + (let select-over-threshold ([table cumulative-table]) + (if (<= rvalue (cdar table)) + (caar table) + (select-over-threshold (cdr table)))))) + +;; ------------- + +(: repeat-fasta (String String Integer Bytes Integer -> Void)) +(define (repeat-fasta id desc n_ sequence line-length) + (let ((seqlen (bytes-length sequence)) + (out (current-output-port))) + (display (string-append +segmarker+ id " " desc "\n") out) + (let: loop-o : Void + ((n : Integer n_) (k : Integer 0)) + (unless (<= n 0) + (let ((m (min n line-length))) + (let loop-i ((i 0) (k k)) + (if (>= i m) + (begin + (newline out) + (loop-o (- n line-length) k)) + (let ([k (if (= k seqlen) 0 k)]) + (write-byte (bytes-ref sequence k) out) + (loop-i (add1 i) (add1 k)))))))))) + +;; ------------- + +(: random-fasta (String String Integer CumulativeTable Integer -> Void)) +(define (random-fasta id desc n_ cumulative-table line-length) + (let ((out (current-output-port))) + (display (string-append +segmarker+ id " " desc "\n") out) + (let: loop-o : Void ((n : Integer n_)) + (unless (<= n 0) + (for ([i (in-range (min n line-length))]) + (write-byte (select-random cumulative-table) out)) + (newline out) + (loop-o (- n line-length)))))) + +;; ------------------------------- + +(let ((n (command-line #:args (n) (assert (string->number (assert n string?)) exact-integer?)))) + + (repeat-fasta "ONE" "Homo sapiens alu" (* n 2) +alu+ +line-size+) + + (random-fasta "TWO" "IUB ambiguity codes" (* n 3) + (make-cumulative-table +iub+) +line-size+) + + (random-fasta "THREE" "Homo sapiens frequency" (* n 5) + (make-cumulative-table +homosapien+) +line-size+)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/fibo-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/fibo-non-optimizing.rkt new file mode 100644 index 0000000000..2bb4d95150 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/fibo-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module fibo-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/fibo-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/fibo-optimizing.rkt new file mode 100644 index 0000000000..366850539f --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/fibo-optimizing.rkt @@ -0,0 +1,2 @@ + +(module fibo-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/fibo.rktl b/collects/tests/racket/benchmarks/shootout/typed/fibo.rktl new file mode 100644 index 0000000000..37f31c4ca2 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/fibo.rktl @@ -0,0 +1,14 @@ +(: fib (Integer -> Integer)) +(define (fib n) + (cond ((< n 2) 1) + (else (+ (fib (- n 2)) (fib (- n 1)))))) + +(: main ((Vectorof String) -> Void)) +(define (main args) + (let ((n (if (= (vector-length args) 0) + 1 + (assert (string->number (vector-ref args 0)) exact-integer?)))) + (display (fib n)) + (newline))) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/hash-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/hash-non-optimizing.rkt new file mode 100644 index 0000000000..d2438916de --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/hash-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module hash-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/hash-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/hash-optimizing.rkt new file mode 100644 index 0000000000..f8665feb1e --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/hash-optimizing.rkt @@ -0,0 +1,2 @@ + +(module hash-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/hash.rktl b/collects/tests/racket/benchmarks/shootout/typed/hash.rktl new file mode 100644 index 0000000000..4b2323c674 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/hash.rktl @@ -0,0 +1,18 @@ +(: main ((Vectorof String) -> Void)) +(define (main argv) + (let*: ([n : Integer (assert (string->number (vector-ref argv 0)) exact-integer?)] + [hash : (HashTable String Integer) (make-hash)] + [accum : Integer 0] + [false : ( -> False) (lambda () #f)]) + (let loop ([i 1]) + (unless (> i n) + (hash-set! hash (number->string i 16) i) + (loop (add1 i)))) + (let loop ([i n]) + (unless (zero? i) + (when (hash-ref hash (number->string i) false) + (set! accum (+ accum 1))) + (loop (sub1 i)))) + (printf "~s~n" accum))) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/hash2-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/hash2-non-optimizing.rkt new file mode 100644 index 0000000000..6363637e6a --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/hash2-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module hash2-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/hash2-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/hash2-optimizing.rkt new file mode 100644 index 0000000000..355df18102 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/hash2-optimizing.rkt @@ -0,0 +1,2 @@ + +(module hash2-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/hash2.rktl b/collects/tests/racket/benchmarks/shootout/typed/hash2.rktl new file mode 100644 index 0000000000..e2f47ccf8f --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/hash2.rktl @@ -0,0 +1,25 @@ +(: main ((Vectorof String) -> Void)) +(define (main argv) + (let*: ([n : Integer (assert (string->number (vector-ref argv 0)) exact-integer?)] + [hash1 : (HashTable String Integer) (make-hash)] + [hash2 : (HashTable String Integer) (make-hash)] + [zero : ( -> 0) (lambda () 0)]) + (let loop ([i 0]) + (unless (= i 10000) + (hash-set! hash1 (string-append "foo_" (number->string i)) i) + (loop (add1 i)))) + (let loop ([i 0]) + (unless (= i n) + (hash-for-each hash1 (lambda: ((key : String) (value : Integer)) + (hash-set! + hash2 + key + (+ (hash-ref hash2 key zero) value)))) + (loop (add1 i)))) + (printf "~s ~s ~s ~s~n" + (hash-ref hash1 "foo_1") + (hash-ref hash1 "foo_9999") + (hash-ref hash2 "foo_1") + (hash-ref hash2 "foo_9999")))) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/heapsort-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/heapsort-non-optimizing.rkt new file mode 100644 index 0000000000..2c4fdc4adb --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/heapsort-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module heapsort-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/heapsort-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/heapsort-optimizing.rkt new file mode 100644 index 0000000000..fb6fb0bdc0 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/heapsort-optimizing.rkt @@ -0,0 +1,2 @@ + +(module heapsort-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/heapsort.rktl b/collects/tests/racket/benchmarks/shootout/typed/heapsort.rktl new file mode 100644 index 0000000000..ff7eb0bba6 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/heapsort.rktl @@ -0,0 +1,72 @@ +;;; heapsort.scm + +;; Prints 0.9990640717878372 instead of 0.9990640718 when n=1000. +;; Updated by Justin Smith +;; +;; Updated by Brent Fulgham to provide proper output formatting + +(require (only-in srfi/13 string-index string-pad-right) + (only-in mzlib/string real->decimal-string)) + +(define IM 139968) +(define IA 3877) +(define IC 29573) + +(: LAST Natural) +(define LAST 42) +(: gen_random (Float -> Float)) +(define (gen_random max) + (set! LAST (modulo (+ (* LAST IA) IC) IM)) + (/ (* max LAST) IM)) + +(: heapsort (Natural (Vectorof Float) -> (U Void True))) +(define (heapsort n ra) + (let: ((ir : Natural n) + (l : Natural (+ (quotient n 2) 1)) + (i : Natural 0) + (j : Natural 0) + (rra : Float 0.0)) + (let/ec: return : True + (do: : Void + ((bar : True #t)) + ((= 1 0)) + (cond ((> l 1) + (set! l (assert (- l 1) exact-nonnegative-integer?)) + (set! rra (vector-ref ra l))) + (else + (set! rra (vector-ref ra ir)) + (vector-set! ra ir (vector-ref ra 1)) + (set! ir (assert (- ir 1) exact-nonnegative-integer?)) + (cond ((<= ir 1) + (vector-set! ra 1 rra) + (return #t))))) + (set! i l) + (set! j (* l 2)) + (do ((foo #t)) + ((> j ir)) + (cond ((and (< j ir) (< (vector-ref ra j) (vector-ref ra (+ j 1)))) + (set! j (+ j 1)))) + (cond ((< rra (vector-ref ra j)) + (vector-set! ra i (vector-ref ra j)) + (set! i j) + (set! j (+ j i))) + (else + (set! j (+ ir 1))))) + (vector-set! ra i rra))))) + +(: main ((Vectorof String) -> Void)) +(define (main args) + (let*: ((n : Natural + (or (and (= (vector-length args) 1) + (assert (string->number (vector-ref args 0)) exact-nonnegative-integer?)) + 1)) + (last : Natural (+ n 1)) + (ary : (Vectorof Float) (make-vector last 0.0))) + (do ((i 1 (+ i 1))) + ((= i last)) + (vector-set! ary i (gen_random 1.0))) + (heapsort n ary) + (printf "~a~n" + (real->decimal-string (vector-ref ary n) 10)))) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/mandelbrot-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/mandelbrot-non-optimizing.rkt new file mode 100644 index 0000000000..84544c1606 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/mandelbrot-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module mandelbrot-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/mandelbrot-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/mandelbrot-optimizing.rkt new file mode 100644 index 0000000000..df60cdda7b --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/mandelbrot-optimizing.rkt @@ -0,0 +1,2 @@ + +(module mandelbrot-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/mandelbrot.rktl b/collects/tests/racket/benchmarks/shootout/typed/mandelbrot.rktl new file mode 100644 index 0000000000..a890034fa4 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/mandelbrot.rktl @@ -0,0 +1,68 @@ +;; The Great Computer Language Shootout +;; http://shootout.alioth.debian.org/ +;; +;; Derived from the Chicken variant, which was +;; Contributed by Anthony Borla + +(require racket/cmdline + racket/flonum) + +(define +limit-sqr+ 4.0) + +(define +iterations+ 50) + +;; ------------------------------- + +(: mandelbrot (Integer Integer Integer Float -> (U 1 0))) +(define (mandelbrot x y n ci) + (let ((cr (fl- (fl/ (fl* 2.0 (->fl x)) (->fl n)) 1.5))) + (let loop ((i 0) (zr 0.0) (zi 0.0)) + (if (> i +iterations+) + 1 + (cond + ((fl> (fl+ (fl* zr zr) (fl* zi zi)) +limit-sqr+) 0) + (else (loop (+ 1 i) + (fl+ (fl- (fl* zr zr) (fl* zi zi)) cr) + (fl+ (fl* 2.0 (fl* zr zi)) ci)))))))) + +;; ------------------------------- + +(: main (Integer -> Void)) +(define (main n) + (let ((out (current-output-port))) + + (fprintf out "P4\n~a ~a\n" n n) + + (let loop-y ((y 0)) + + (when (< y n) + + (let ([ci (fl- (fl/ (fl* 2.0 (->fl y)) (->fl n)) 1.0)]) + + (let: loop-x : Void + ((x : Natural 0) (bitnum : Natural 0) (byteacc : Natural 0)) + + (if (< x n) + (let: ([bitnum : Natural (+ 1 bitnum)] + [byteacc : Natural (+ (arithmetic-shift byteacc 1) + (mandelbrot x y n ci))]) + + (cond + ((= bitnum 8) + (write-byte byteacc out) + (loop-x (+ 1 x) 0 0)) + + [else (loop-x (+ 1 x) bitnum byteacc)])) + + (begin + (when (positive? bitnum) + (write-byte (arithmetic-shift byteacc + (assert (- 8 (bitwise-and n #x7)) exact-nonnegative-integer?)) + out)) + + (loop-y (add1 y)))))))))) + +;; ------------------------------- + +(command-line #:args (n) + (main (assert (string->number (assert n string?)) exact-integer?))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/matrix-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/matrix-non-optimizing.rkt new file mode 100644 index 0000000000..74582f38a7 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/matrix-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module matrix-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/matrix-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/matrix-optimizing.rkt new file mode 100644 index 0000000000..5f428614d4 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/matrix-optimizing.rkt @@ -0,0 +1,2 @@ + +(module matrix-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/matrix.rktl b/collects/tests/racket/benchmarks/shootout/typed/matrix.rktl new file mode 100644 index 0000000000..7ad91fbb60 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/matrix.rktl @@ -0,0 +1,92 @@ +;; Matrix.scm + +(define-type Matrix (Vectorof (Vectorof Natural))) + +(define size 30) + +(: 1+ (Natural -> Natural)) +(define (1+ x) (+ x 1)) + +(: mkmatrix (Natural Natural -> Matrix)) +(define (mkmatrix rows cols) + (let: ((mx : Matrix (make-vector rows (ann (vector 0) (Vectorof Natural)))) + (count : Natural 1)) + (do: : Void + ((i : Natural 0 (1+ i))) + ((= i rows)) + (let: ((row : (Vectorof Natural) (make-vector cols 0))) + (do: : Void + ((j : Natural 0 (1+ j))) + ((= j cols)) + (vector-set! row j count) + (set! count (+ count 1))) + (vector-set! mx i row))) + mx)) + +(: num-cols (Matrix -> Natural)) +(define (num-cols mx) + (let ((row (vector-ref mx 0))) + (vector-length row))) + +(: num-rows (Matrix -> Natural)) +(define (num-rows mx) + (vector-length mx)) + +(: mmult (Natural Natural Matrix Matrix -> Matrix)) +(define (mmult rows cols m1 m2) + (let: ((m3 : Matrix (make-vector rows (ann (vector 0) (Vectorof Natural))))) + (do: : Void + ((i : Natural 0 (1+ i))) + ((= i rows)) + (let: ((m1i : (Vectorof Natural) (vector-ref m1 i)) + (row : (Vectorof Natural) (make-vector cols 0))) + (do: : Void + ((j : Natural 0 (1+ j))) + ((= j cols)) + (let: ((val : Natural 0)) + (do: : Void + ((k : Natural 0 (1+ k))) + ((= k cols)) + (set! val (+ val (* (vector-ref m1i k) + (vector-ref (vector-ref m2 k) j))))) + (vector-set! row j val))) + (vector-set! m3 i row))) + m3)) + +(: matrix-print (Matrix -> Void)) +(define (matrix-print m) + (do: : Void + ((i : Natural 0 (1+ i))) + ((= i (num-rows m))) + (let ((row (vector-ref m i))) + (do: : Void + ((j : Natural 0 (1+ j))) + ((= j (num-cols m))) + (display (vector-ref row j)) + (if (< j (num-cols m)) + (display " ") + #t)) + (newline)))) + +(define (print-list . items) (for-each display items) (newline)) + +(: main ((Vectorof String) -> Void)) +(define (main args) + (let ((n (or (and (= (vector-length args) 1) + (assert (string->number (vector-ref args 0)) exact-integer?)) + 1))) + (let: ((mm : Matrix (vector (vector 0))) + (m1 : Matrix (mkmatrix size size)) + (m2 : Matrix (mkmatrix size size))) + (let loop ((iter n)) + (cond ((> iter 0) + (set! mm (mmult size size m1 m2)) + (loop (- iter 1))))) + (let ((r0 (vector-ref mm 0)) + (r2 (vector-ref mm 2)) + (r3 (vector-ref mm 3)) + (r4 (vector-ref mm 4))) + (print-list (vector-ref r0 0) " " (vector-ref r2 3) " " + (vector-ref r3 2) " " (vector-ref r4 4)))))) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/moments-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/moments-non-optimizing.rkt new file mode 100644 index 0000000000..0109ddfe12 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/moments-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module moments-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/moments-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/moments-optimizing.rkt new file mode 100644 index 0000000000..aaca9875e6 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/moments-optimizing.rkt @@ -0,0 +1,2 @@ + +(module moments-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/moments.rktl b/collects/tests/racket/benchmarks/shootout/typed/moments.rktl new file mode 100644 index 0000000000..83c1205539 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/moments.rktl @@ -0,0 +1,72 @@ +;; Moments.scm + +(require (only-in mzlib/list sort) + (only-in mzlib/string real->decimal-string) + racket/flonum) + +(: to-str (Number -> String)) +(define (to-str n) (real->decimal-string n 6)) + +(let*: ((sum : Float 0.0) + (numlist : (Listof Float) + (let: loop : (Listof Float) + ((line : String (read-line)) + (numlist : (Listof Float) '())) + (cond ((eof-object? line) numlist) + (else + (let ((num (exact->inexact (assert (string->number line) real?)))) + (set! sum (+ num sum)) + (loop (read-line) (cons num numlist)))))))) + (unless (null? numlist) + (let ((n (length numlist))) + (let: ((mean : Float (/ sum n)) + (average_deviation : Float 0.0) + (standard_deviation : Float 0.0) + (variance : Float 0.0) + (skew : Float 0.0) + (kurtosis : Float 0.0) + (median : Float 0.0) + (deviation : Float 0.0)) + (let loop ((nums numlist)) + (if (not (null? nums)) + (begin + (set! deviation (- (car nums) mean)) + (set! average_deviation (+ average_deviation (abs deviation))) + (set! variance (+ variance (expt deviation 2))) + (set! skew (+ skew (expt deviation 3))) + (set! kurtosis (+ kurtosis (expt deviation 4))) + (loop (cdr nums))) + #t)) + + (set! average_deviation (/ average_deviation (exact->inexact n))) + (set! variance (/ variance (- n 1))) + (set! standard_deviation (flsqrt variance)) + + (cond ((> variance 0.0) + (set! skew (/ skew (* n variance standard_deviation))) + (set! kurtosis (- (/ kurtosis (* n variance variance)) + 3.0)))) + + (set! numlist ((inst sort Float Float) numlist (lambda: ((x : Float) (y : Float)) + (< x y)))) + + (let ((mid (quotient n 2))) + (if (zero? (modulo n 2)) + (set! median (/ (+ (car (list-tail numlist mid)) + (car (list-tail numlist (assert (- mid 1) exact-nonnegative-integer?)))) + 2.0)) + (set! median (car (list-tail numlist mid))))) + + + (set! standard_deviation (/ (round (* standard_deviation 1000000)) + 1000000)) + + (for-each display + `("n: " ,n "\n" + "median: " ,(to-str median) "\n" + "mean: " ,(to-str mean) "\n" + "average_deviation: " ,(to-str average_deviation ) "\n" + "standard_deviation: " ,(to-str standard_deviation) "\n" + "variance: " ,(to-str variance)"\n" + "skew: " ,(to-str skew) "\n" + "kurtosis: " ,(to-str kurtosis)"\n" )))))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/nbody-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/nbody-non-optimizing.rkt new file mode 100644 index 0000000000..ada68bb628 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nbody-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module nbody-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/nbody-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/nbody-optimizing.rkt new file mode 100644 index 0000000000..02034efd5d --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nbody-optimizing.rkt @@ -0,0 +1,2 @@ + +(module nbody-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/nbody.rktl b/collects/tests/racket/benchmarks/shootout/typed/nbody.rktl new file mode 100644 index 0000000000..9828756499 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nbody.rktl @@ -0,0 +1,161 @@ +;; The Computer Language Benchmarks Game +;; http://shootout.alioth.debian.org/ +;; +;; Imperative-style implementation based on the SBCL implementation by +;; Patrick Frankenberger and Juho Snellman, but using only native Scheme +;; idioms like 'named let' and 'do' special form. +;; +;; Contributed by Anthony Borla, then converted for Racket +;; by Matthew Flatt and Brent Fulgham + +#| +Correct output N = 1000 is + +-0.169075164 +-0.169087605 +|# + +(require racket/cmdline + racket/flonum) + +;; ------------------------------ +;; define planetary masses, initial positions & velocity + +(define +pi+ 3.141592653589793) +(define +days-per-year+ 365.24) + +(define +solar-mass+ (* 4.0 +pi+ +pi+)) + +(define +dt+ 0.01) + +(define-struct: body ((x : Float) (y : Float) (z : Float) + (vx : Float) (vy : Float) (vz : Float) + (mass : Float)) + #:mutable) + +(define *sun* + (make-body 0.0 0.0 0.0 0.0 0.0 0.0 +solar-mass+)) + +(define *jupiter* + (make-body 4.84143144246472090 + -1.16032004402742839 + -1.03622044471123109e-1 + (* 1.66007664274403694e-3 +days-per-year+) + (* 7.69901118419740425e-3 +days-per-year+) + (* -6.90460016972063023e-5 +days-per-year+) + (* 9.54791938424326609e-4 +solar-mass+))) + +(define *saturn* + (make-body 8.34336671824457987 + 4.12479856412430479 + -4.03523417114321381e-1 + (* -2.76742510726862411e-3 +days-per-year+) + (* 4.99852801234917238e-3 +days-per-year+) + (* 2.30417297573763929e-5 +days-per-year+) + (* 2.85885980666130812e-4 +solar-mass+))) + +(define *uranus* + (make-body 1.28943695621391310e1 + -1.51111514016986312e1 + -2.23307578892655734e-1 + (* 2.96460137564761618e-03 +days-per-year+) + (* 2.37847173959480950e-03 +days-per-year+) + (* -2.96589568540237556e-05 +days-per-year+) + (* 4.36624404335156298e-05 +solar-mass+))) + +(define *neptune* + (make-body 1.53796971148509165e+01 + -2.59193146099879641e+01 + 1.79258772950371181e-01 + (* 2.68067772490389322e-03 +days-per-year+) + (* 1.62824170038242295e-03 +days-per-year+) + (* -9.51592254519715870e-05 +days-per-year+) + (* 5.15138902046611451e-05 +solar-mass+))) + +(define *system* (list *sun* *jupiter* *saturn* *uranus* *neptune*)) + +;; ------------------------------- +(: offset-momentum ( -> Void)) +(define (offset-momentum) + (let loop-i ([i *system*] [px 0.0] [py 0.0] [pz 0.0]) + (if (null? i) + (begin + (set-body-vx! (car *system*) (fl/ (fl- 0.0 px) +solar-mass+)) + (set-body-vy! (car *system*) (fl/ (fl- 0.0 py) +solar-mass+)) + (set-body-vz! (car *system*) (fl/ (fl- 0.0 pz) +solar-mass+))) + (let ([i1 (car i)]) + (loop-i (cdr i) + (fl+ px (fl* (body-vx i1) (body-mass i1))) + (fl+ py (fl* (body-vy i1) (body-mass i1))) + (fl+ pz (fl* (body-vz i1) (body-mass i1)))))))) + +;; ------------------------------- +(: energy ( -> Float)) +(define (energy) + (let loop-o ([o *system*] [e 0.0]) + (if (null? o) + e + (let* ([o1 (car o)] + [e (+ e (fl* 0.5 + (fl* (body-mass o1) + (fl+ (fl+ (fl* (body-vx o1) (body-vx o1)) + (fl* (body-vy o1) (body-vy o1))) + (fl* (body-vz o1) (body-vz o1))))))]) + (let loop-i ([i (cdr o)] [e e]) + (if (null? i) + (loop-o (cdr o) e) + (let* ([i1 (car i)] + [dx (fl- (body-x o1) (body-x i1))] + [dy (fl- (body-y o1) (body-y i1))] + [dz (fl- (body-z o1) (body-z i1))] + [dist (flsqrt (fl+ (fl+ (fl* dx dx) (fl* dy dy)) (fl* dz dz)))] + [e (fl- e (fl/ (fl* (body-mass o1) (body-mass i1)) dist))]) + (loop-i (cdr i) e)))))))) + +;; ------------------------------- +(: advance ( -> Void)) +(define (advance) + (let loop-o ([o *system*]) + (when (pair? o) + (let* ([o1 (car o)] + [o1x (body-x o1)] + [o1y (body-y o1)] + [o1z (body-z o1)] + [om (body-mass o1)]) + (let loop-i ([i (cdr o)] + [vx (body-vx o1)] + [vy (body-vy o1)] + [vz (body-vz o1)]) + (if (pair? i) + (let* ([i1 (car i)] + [dx (fl- o1x (body-x i1))] + [dy (fl- o1y (body-y i1))] + [dz (fl- o1z (body-z i1))] + [dist2 (fl+ (fl+ (fl* dx dx) (fl* dy dy)) (fl* dz dz))] + [mag (fl/ +dt+ (fl* dist2 (flsqrt dist2)))] + [dxmag (fl* dx mag)] + [dymag (fl* dy mag)] + [dzmag (fl* dz mag)] + [im (body-mass i1)]) + (set-body-vx! i1 (fl+ (body-vx i1) (fl* dxmag om))) + (set-body-vy! i1 (fl+ (body-vy i1) (fl* dymag om))) + (set-body-vz! i1 (fl+ (body-vz i1) (fl* dzmag om))) + (loop-i (cdr i) + (fl- vx (fl* dxmag im)) + (fl- vy (fl* dymag im)) + (fl- vz (fl* dzmag im)))) + (begin (set-body-vx! o1 vx) + (set-body-vy! o1 vy) + (set-body-vz! o1 vz) + (set-body-x! o1 (fl+ o1x (fl* +dt+ vx))) + (set-body-y! o1 (fl+ o1y (fl* +dt+ vy))) + (set-body-z! o1 (fl+ o1z (fl* +dt+ vz))))))) + (loop-o (cdr o))))) + +;; ------------------------------- + +(let ([n (command-line #:args (n) (assert (string->number (assert n string?)) exact-integer?))]) + (offset-momentum) + (printf "~a\n" (real->decimal-string (energy) 9)) + (for ([i (in-range n)]) (advance)) + (printf "~a\n" (real->decimal-string (energy) 9))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/nestedloop-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/nestedloop-non-optimizing.rkt new file mode 100644 index 0000000000..0d9e42809a --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nestedloop-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module nestedloop-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/nestedloop-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/nestedloop-optimizing.rkt new file mode 100644 index 0000000000..2dae0fc562 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nestedloop-optimizing.rkt @@ -0,0 +1,2 @@ + +(module nestedloop-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/nestedloop.rktl b/collects/tests/racket/benchmarks/shootout/typed/nestedloop.rktl new file mode 100644 index 0000000000..d96589383a --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nestedloop.rktl @@ -0,0 +1,18 @@ +(require mzlib/defmacro) + +(define-macro (nest n expr) + (if (> n 0) + `(let loop ([i 1]) (unless (> i n) + (nest ,(- n 1) ,expr) + (loop (add1 i)))) + expr)) + + +(: main ((Vectorof String) -> Void)) +(define (main argv) + (let*: ([n : Integer (assert (string->number (vector-ref argv 0)) exact-integer?)] + [x : Integer 0]) + (nest 6 (set! x (+ x 1))) + (printf "~s~n" x))) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/nsieve-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/nsieve-non-optimizing.rkt new file mode 100644 index 0000000000..749acdca7d --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nsieve-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module nsieve-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/nsieve-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/nsieve-optimizing.rkt new file mode 100644 index 0000000000..e9f9143308 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nsieve-optimizing.rkt @@ -0,0 +1,2 @@ + +(module nsieve-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/nsieve.rktl b/collects/tests/racket/benchmarks/shootout/typed/nsieve.rktl new file mode 100644 index 0000000000..c8d7d50a9b --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nsieve.rktl @@ -0,0 +1,46 @@ +;; $Id: nsieve-mzscheme.code,v 1.6 2006/06/10 23:38:29 bfulgham Exp $ +;; The Great Computer Language Shootout +;; http://shootout.alioth.debian.org/ +;; +;; nsieve benchmark for The Computer Language Shootout +;; Written by Dima Dorfman, 2004 +;; Converted to MzScheme by Brent Fulgham +;; Converted to Typed Scheme by Vincent St-Amour + +(require scheme/cmdline) + +(: nsieve (Natural -> Natural)) +(define (nsieve m) + (let: ((a : (Vectorof Boolean) (make-vector m #t))) + (let loop ((i 2) (n 0)) + (if (< i m) + (if (vector-ref a i) + (begin + (let clear ((j (+ i i))) + (when (< j m) + (vector-set! a j #f) + (clear (+ j i)))) + (loop (+ 1 i) (+ 1 n))) + (loop (+ 1 i) n)) + n)))) + +(: string-pad (String Natural -> String)) +(define (string-pad s len) + (string-append (make-string (assert (- len (string-length s)) exact-nonnegative-integer?) #\space) + s)) + +(: test (Natural -> Void)) +(define (test n) + (let* ((m (* (expt 2 n) 10000)) + (count (nsieve m))) + (printf "Primes up to ~a ~a\n" + (string-pad (number->string m) 8) + (string-pad (number->string count) 8)))) + +(: main (Natural -> Void)) +(define (main n) + (when (>= n 0) (test n)) + (when (>= n 1) (test (assert (- n 1) exact-nonnegative-integer?))) + (when (>= n 2) (test (assert (- n 2) exact-nonnegative-integer?)))) + +(command-line #:args (n) (main (assert (string->number (assert n string?)) exact-nonnegative-integer?))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/nsievebits-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/nsievebits-non-optimizing.rkt new file mode 100644 index 0000000000..6dcbba33f3 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nsievebits-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module nsievebits-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/nsievebits-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/nsievebits-optimizing.rkt new file mode 100644 index 0000000000..6cb8129436 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nsievebits-optimizing.rkt @@ -0,0 +1,2 @@ + +(module nsievebits-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/nsievebits.rktl b/collects/tests/racket/benchmarks/shootout/typed/nsievebits.rktl new file mode 100644 index 0000000000..de847e8bd4 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/nsievebits.rktl @@ -0,0 +1,74 @@ +;;; The Great Computer Language Shootout +;;; http://shootout.alioth.debian.org/ +;; +;; Adapted from CMUCL code by Dima Dorfman; bit-vector stuff by Alex Shinn; +;; cobbled together by felix, converted to MzScheme by Brent Fulgham +;; converted to Typed Scheme by Vincent St-Amour + +(require scheme/cmdline) + +(: make-bit-vector (Natural -> Bytes)) +(define (make-bit-vector size) + (let* ((len (quotient (+ size 7) 8)) + (res (make-bytes len #b11111111))) + (let ((off (remainder size 8))) + (unless (zero? off) + (bytes-set! res (- len 1) (- (arithmetic-shift 1 off) 1)))) + res)) + +(: bit-vector-ref (Bytes Natural -> Boolean)) +(define (bit-vector-ref vec i) + (let ((byte (arithmetic-shift i -3)) + (off (bitwise-and i #x7))) + (and (< byte (bytes-length vec)) + (not (zero? (bitwise-and (bytes-ref vec byte) + (arithmetic-shift 1 off))))))) + +(: bit-vector-set! (Bytes Natural Boolean -> Void)) +(define (bit-vector-set! vec i x) + (let ((byte (arithmetic-shift i -3)) + (off (bitwise-and i #x7))) + (let ((val (bytes-ref vec byte)) + (mask (arithmetic-shift 1 off))) + (bytes-set! vec + byte + (if x + (bitwise-ior val mask) + (bitwise-and val (bitwise-not mask))))))) + +(: nsievebits (Natural -> Natural)) +(define (nsievebits m) + (let ((a (make-bit-vector m))) + (: clear (Natural -> Void)) + (define (clear i) + (do: : Void + ([j : Natural (+ i i) (+ j i)]) + ((>= j m)) + (bit-vector-set! a j #f))) + (let: ([c : Natural 0]) + (do ([i 2 (add1 i)]) + ((>= i m) c) + (when (bit-vector-ref a i) + (clear i) + (set! c (add1 c))))))) + +(: string-pad (String Natural -> String)) +(define (string-pad s len) + (string-append (make-string (assert (- len (string-length s)) exact-nonnegative-integer?) #\space) + s)) + +(: test (Natural -> Void)) +(define (test n) + (let* ((m (* (expt 2 n) 10000)) + (count (nsievebits m))) + (printf "Primes up to ~a ~a\n" + (string-pad (number->string m) 8) + (string-pad (number->string count) 8)))) + +(: main (Natural -> Void)) +(define (main n) + (when (>= n 0) (test n)) + (when (>= n 1) (test (assert (- n 1) exact-nonnegative-integer?))) + (when (>= n 2) (test (assert (- n 2) exact-nonnegative-integer?)))) + +(command-line #:args (n) (main (assert (string->number (assert n string?)) exact-nonnegative-integer?))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/partialsums-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/partialsums-non-optimizing.rkt new file mode 100644 index 0000000000..ef2f44b5fb --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/partialsums-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module partialsums-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/partialsums-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/partialsums-optimizing.rkt new file mode 100644 index 0000000000..95fc5dce40 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/partialsums-optimizing.rkt @@ -0,0 +1,2 @@ + +(module partialsums-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/partialsums.rktl b/collects/tests/racket/benchmarks/shootout/typed/partialsums.rktl new file mode 100644 index 0000000000..486653e9b6 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/partialsums.rktl @@ -0,0 +1,57 @@ +;; --------------------------------------------------------------------- +;; The Great Computer Language Shootout +;; http://shootout.alioth.debian.org/ +;; +;; Based on D language implementation by Dave Fladebo [imperative version] +;; +;; Derived from the Chicken variant, which was +;; Contributed by Anthony Borla +;; --------------------------------------------------------------------- + +(require scheme/cmdline) +(require scheme/flonum) + +(let ((n (exact->inexact (assert (string->number (command-line #:args (n) (assert n string?))))))) + + (let: loop : Void + ([d : Float 0.0] + (alt : Float 1.0) (d2 : Float 0.0) (d3 : Float 0.0) + (ds : Float 0.0) (dc : Float 0.0) + (s0 : Float 0.0) (s1 : Float 0.0) (s2 : Float 0.0) + (s3 : Float 0.0) (s4 : Float 0.0) (s5 : Float 0.0) + (s6 : Float 0.0) (s7 : Float 0.0) (s8 : Float 0.0)) + (if (= d n) + (let ([format-result + (lambda: ((str : String) (n : Float)) + (printf str (real->decimal-string n 9)))]) + + (format-result "~a\t(2/3)^k\n" s0) + (format-result "~a\tk^-0.5\n" s1) + (format-result "~a\t1/k(k+1)\n" s2) + (format-result "~a\tFlint Hills\n" s3) + (format-result "~a\tCookson Hills\n" s4) + (format-result "~a\tHarmonic\n" s5) + (format-result "~a\tRiemann Zeta\n" s6) + (format-result "~a\tAlternating Harmonic\n" s7) + (format-result "~a\tGregory\n" s8)) + + (let*: ((d : Float (+ d 1)) + (d2 : Float (* d d)) + (d3 : Float (* d2 d)) + (ds : Float (sin d)) + (dc : Float (cos d)) + + (s0 : Float (+ s0 (assert (expt (/ 2.0 3) (- d 1)) real?))) + (s1 : Float (+ s1 (/ 1 (flsqrt d)))) + (s2 : Float (+ s2 (/ 1 (* d (+ d 1))))) + (s3 : Float (+ s3 (/ 1 (* d3 (* ds ds))))) + (s4 : Float (+ s4 (/ 1 (* d3 (* dc dc))))) + (s5 : Float (+ s5 (/ 1 d))) + (s6 : Float (+ s6 (/ 1 d2))) + (s7 : Float (+ s7 (/ alt d))) + (s8 : Float (+ s8 (/ alt (- (* 2 d) 1)))) + (alt : Float (- alt))) + + (loop d + alt d2 d3 ds dc + s0 s1 s2 s3 s4 s5 s6 s7 s8))))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/pidigits-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/pidigits-non-optimizing.rkt new file mode 100644 index 0000000000..370f93510a --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/pidigits-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module pidigits-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/pidigits-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/pidigits-optimizing.rkt new file mode 100644 index 0000000000..f4fbc5005e --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/pidigits-optimizing.rkt @@ -0,0 +1,2 @@ + +(module pidigits-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/pidigits.rktl b/collects/tests/racket/benchmarks/shootout/typed/pidigits.rktl new file mode 100644 index 0000000000..c508701015 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/pidigits.rktl @@ -0,0 +1,55 @@ +;; The Computer Language Shootout +;; http://shootout.alioth.debian.org/ +;; Based on the MLton version of the benchmark +;; contributed by Scott Cruzen + +(require racket/cmdline) + +(: floor_ev (Integer Integer Integer Integer Integer -> Integer)) +(define (floor_ev q r s t x) + (quotient (+ (* q x) r) (+ (* s x) t))) + +(: comp (Integer Integer Integer Integer Integer Integer Integer Integer + -> (values Integer Integer Integer Integer))) +(define (comp q r s t q2 r2 s2 t2) + (values (+ (* q q2) (* r s2)) + (+ (* q r2) (* r t2)) + (+ (* s q2) (* t s2)) + (+ (* s r2) (* t t2)))) + +(: next (Integer Integer Integer Integer -> Integer)) +(define (next q r s t) (floor_ev q r s t 3)) +(: safe? (Integer Integer Integer Integer Integer -> Boolean)) +(define (safe? q r s t n) (= n (floor_ev q r s t 4))) +(: prod (Integer Integer Integer Integer Integer + -> (values Integer Integer Integer Integer))) +(define (prod q r s t n) (comp 10 (* -10 n) 0 1 q r s t)) +(: mk (Integer Integer Integer Integer Integer + -> (values Integer Integer Integer Integer))) +(define (mk q r s t k) (comp q r s t k (* 2 (add1 (* 2 k))) 0 (add1 (* 2 k)))) + +(: digit (Integer Integer Integer Integer Integer Integer Integer Integer + -> Void)) +(define (digit k q r s t n row col) + (if (> n 0) + (let ([y (next q r s t)]) + (if (safe? q r s t y) + (let-values ([(q r s t) (prod q r s t y)]) + (if (= col 10) + (let ([row (+ row 10)]) + (printf "\t:~a\n~a" row y) + (digit k q r s t (sub1 n) row 1)) + (begin + (printf "~a" y) + (digit k q r s t (sub1 n) row (add1 col))))) + (let-values ([(q r s t) (mk q r s t k)]) + (digit (add1 k) q r s t n row col)))) + (printf "~a\t:~a\n" + (make-string (assert (- 10 col) exact-nonnegative-integer?) #\space) + (+ row col)))) + +(: digits (Integer -> Void)) +(define (digits n) + (digit 1 1 0 0 1 n 0 0)) + +(digits (command-line #:args (n) (assert (string->number (assert n string?)) exact-integer?))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/pidigits1-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/pidigits1-non-optimizing.rkt new file mode 100644 index 0000000000..bc78132f7a --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/pidigits1-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module pidigits1-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/pidigits1-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/pidigits1-optimizing.rkt new file mode 100644 index 0000000000..046f54a96c --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/pidigits1-optimizing.rkt @@ -0,0 +1,2 @@ + +(module pidigits1-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/pidigits1.rktl b/collects/tests/racket/benchmarks/shootout/typed/pidigits1.rktl new file mode 100644 index 0000000000..fc372a68fc --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/pidigits1.rktl @@ -0,0 +1,58 @@ +; The Computer Language Shootout +; http://shootout.alioth.debian.org/ +; Sven Hartrumpf 2005-04-12 +; Implements 'Spigot' algorithm origionally due to Stanly Rabinowitz. +; This program is based on an implementation for SCM by Aubrey Jaffer and +; Jerry D. Hedden. + +(: pi (Natural Natural -> Void)) +(define (pi n d) + (let*: ((r : Natural (assert (inexact->exact (floor (exp (* d (log 10))))) exact-nonnegative-integer?)) ; 10^d + (p : Natural (+ (quotient n d) 1)) + (m : Natural (quotient (* p d 3322) 1000)) + (a : (Vectorof Natural) (make-vector (+ m 1) 2)) + (out : Output-Port (current-output-port))) + (vector-set! a m 4) + (let: j-loop : Void + ([b : Natural 2][digits : Natural 0]) + (if (= digits n) + ;; Add whitespace for ungenerated digits + (let ([left (modulo digits 10)]) + (unless (zero? left) + (fprintf out "~a\t:~a\n" (make-string (assert (- 10 left) exact-nonnegative-integer?) #\space) n))) + ;; Compute more digits + (let loop ([k m][q 0]) + (if (zero? k) + (let* ((s (let ([s (number->string (+ b (quotient q r)))]) + (if (zero? digits) + s + (string-append (make-string (assert (- d (string-length s)) exact-nonnegative-integer?) #\0) s))))) + (j-loop (remainder q r) + (print-digits out s 0 (string-length s) digits n))) + (let ([q (+ q (* (vector-ref a k) r))]) + (let ((t (+ (* k 2) 1))) + (let-values ([(qt rr) (quotient/remainder q t)]) + (vector-set! a k rr) + (loop (sub1 k) (* k qt))))))))))) + +(: print-digits (Output-Port String Natural Natural Natural Natural -> Natural)) +(define (print-digits out s start end digits n) + (let*: ([len : Natural (assert (- end start) exact-nonnegative-integer?)] + [cnt : Natural (assert (min len (- n digits) (- 10 (modulo digits 10)) len) exact-nonnegative-integer?)]) + (if (zero? cnt) + digits + (begin + (write-string s out start (+ start cnt)) + (let ([digits (+ digits cnt)]) + (when (zero? (modulo digits 10)) + (fprintf out "\t:~a\n" digits)) + (print-digits out s (+ start cnt) end digits n)))))) + +(: main ((Vectorof String) -> Void)) +(define (main args) + (let ((n (if (= (vector-length args) 0) + 1 + (assert (string->number (vector-ref args 0)) exact-nonnegative-integer?)))) + (pi n 10))) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/random-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/random-non-optimizing.rkt new file mode 100644 index 0000000000..511d90dc7a --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/random-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module random-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/random-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/random-optimizing.rkt new file mode 100644 index 0000000000..5e4538ee33 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/random-optimizing.rkt @@ -0,0 +1,2 @@ + +(module random-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/random.rktl b/collects/tests/racket/benchmarks/shootout/typed/random.rktl new file mode 100644 index 0000000000..c6cdff8485 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/random.rktl @@ -0,0 +1,39 @@ +;;; http://shootout.alioth.debian.org/ +;;; Random implementation, by Jens Axel Sogaard +;;; +;;; Modified for proper string output by Brent Fulgham +;;; Modified for Typed Scheme by Vincent St-Amour + +(require (only-in mzlib/string real->decimal-string)) + +(define IM 139968) +(define IA 3877) +(define IC 29573) + +(define gen_random + (let: ((LAST : Integer 42)) + (lambda: ((max : Float)) + (set! LAST (modulo (+ (* LAST IA) IC) IM)) + (/ (* max LAST) IM)))) + +(: roundto (Natural Float -> String)) +(define (roundto digits num) + (let*: ([e : Integer (expt 10 digits)] + [num : Integer (round (* e (inexact->exact num)))]) + (format "~a.~a" + (quotient num e) + (substring (string-append (number->string (remainder num e)) + (make-string digits #\0)) + 0 digits)))) + +(let ((n (assert (string->number + (vector-ref (current-command-line-arguments) + 0)) exact-integer?))) + (let loop ((iter n)) + (if (> iter 1) + (begin + (gen_random 100.0) + (loop (- iter 1))) + #t)) + (printf "~a~%" + (real->decimal-string (gen_random 100.0) 9))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/recursive-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/recursive-non-optimizing.rkt new file mode 100644 index 0000000000..e79aaa7241 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/recursive-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module recursive-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/recursive-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/recursive-optimizing.rkt new file mode 100644 index 0000000000..678c714d78 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/recursive-optimizing.rkt @@ -0,0 +1,2 @@ + +(module recursive-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/recursive.rktl b/collects/tests/racket/benchmarks/shootout/typed/recursive.rktl new file mode 100644 index 0000000000..b5f60745a6 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/recursive.rktl @@ -0,0 +1,64 @@ +;; --------------------------------------------------------------------- +;; The Great Computer Language Shootout +;; http://shootout.alioth.debian.org/ +;; +;; Code based on / inspired by existing, relevant Shootout submissions +;; +;; Derived from the Chicken variant, which was +;; Contributed by Anthony Borla +;; --------------------------------------------------------------------- + +(require scheme/cmdline + scheme/flonum) + +;; ------------------------------- + +(: ack (Integer Integer -> Integer)) +(define (ack m n) + (cond ((zero? m) (+ n 1)) + ((zero? n) (ack (- m 1) 1)) + (else (ack (- m 1) (ack m (- n 1)))))) + +;; -------------- + +(: fib (Integer -> Integer)) +(define (fib n) + (cond ((< n 2) 1) + (else (+ (fib (- n 2)) (fib (- n 1)))))) + +(: fibflt (Float -> Float)) +(define (fibflt n) + (cond ((fl< n 2.0) 1.0) + (else (fl+ (fibflt (fl- n 2.0)) (fibflt (fl- n 1.0)))))) + +;; -------------- + +(: tak (Integer Integer Integer -> Integer)) +(define (tak x y z) + (cond ((not (< y x)) z) + (else (tak (tak (- x 1) y z) (tak (- y 1) z x) (tak (- z 1) x y))))) + +(: takflt (Float Float Float -> Float)) +(define (takflt x y z) + (cond ((not (fl< y x)) z) + (else (takflt (takflt (fl- x 1.0) y z) (takflt (fl- y 1.0) z x) (takflt (fl- z 1.0) x y))))) + +;; ------------------------------- + +(: main (Integer -> Void)) +(define (main n) + + (printf "Ack(3,~A): ~A~%" n (ack 3 n)) + (printf "Fib(~a): ~a~%" + (real->decimal-string (+ 27.0 n) 1) + (real->decimal-string (fibflt (+ 27.0 n)) 1)) + + (set! n (- n 1)) + (printf "Tak(~A,~A,~A): ~A~%" (* n 3) (* n 2) n (tak (* n 3) (* n 2) n)) + + (printf "Fib(3): ~A~%" (fib 3)) + (printf "Tak(3.0,2.0,1.0): ~a~%" (real->decimal-string (takflt 3.0 2.0 1.0) 1))) + +;; ------------------------------- + +(main (command-line #:args (n) (assert (string->number (assert n string?)) exact-integer?))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/regexpdna-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/regexpdna-non-optimizing.rkt new file mode 100644 index 0000000000..e5c335d887 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/regexpdna-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module regexpdna-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/regexpdna-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/regexpdna-optimizing.rkt new file mode 100644 index 0000000000..aaa2fa5ea3 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/regexpdna-optimizing.rkt @@ -0,0 +1,2 @@ + +(module regexpdna-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/regexpdna.rktl b/collects/tests/racket/benchmarks/shootout/typed/regexpdna.rktl new file mode 100644 index 0000000000..fc30c6c7aa --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/regexpdna.rktl @@ -0,0 +1,57 @@ +;; The Great Computer Language Shootout +;; http://shootout.alioth.debian.org/ +;; +;; Based on a version by by Anthony Borla + +(require racket/port) + +;; ------------------------------- + +(define VARIANTS + '(#"agggtaaa|tttaccct" #"[cgt]gggtaaa|tttaccc[acg]" #"a[act]ggtaaa|tttacc[agt]t" + #"ag[act]gtaaa|tttac[agt]ct" #"agg[act]taaa|ttta[agt]cct" #"aggg[acg]aaa|ttt[cgt]ccct" + #"agggt[cgt]aa|tt[acg]accct" #"agggta[cgt]a|t[acg]taccct" #"agggtaa[cgt]|[acg]ttaccct")) + + +(define IUBS + '((#"B" #"(c|g|t)") (#"D" #"(a|g|t)") (#"H" #"(a|c|t)") + (#"K" #"(g|t)") (#"M" #"(a|c)") (#"N" #"(a|c|g|t)") + (#"R" #"(a|g)") (#"S" #"(c|g)") (#"V" #"(a|c|g)") + (#"W" #"(a|t)") (#"Y" #"(c|t)"))) + +;; ------------------------------- + +(: ci-byte-regexp (Bytes -> Byte-Regexp)) +(define (ci-byte-regexp s) + (byte-regexp (bytes-append #"(?i:" s #")"))) + +;; ------------------------------- + +(: match-count (Bytes Byte-Regexp Natural Natural -> Natural)) +(define (match-count str rx offset cnt) + (let ([m (regexp-match-positions rx str offset)]) + (if m + (match-count str rx (cdr (assert (car m))) (add1 cnt)) + cnt))) + +;; ------------------------------- + +;; Load sequence and record its length +(let* ([orig (port->bytes)] + [filtered (regexp-replace* #rx#"(?:>.*?\n)|\n" orig #"")]) + + ;; Perform regexp counts + (for ([i (in-list VARIANTS)]) + (printf "~a ~a\n" i (match-count filtered (ci-byte-regexp i) 0 0))) + + ;; Perform regexp replacements, and record sequence length + (let ([replaced + (for/fold: : Bytes + ([sequence : Bytes filtered]) + ([IUB : (List Bytes Bytes) IUBS]) + (regexp-replace* (byte-regexp (car IUB)) sequence (cadr IUB)))]) + ;; Print statistics + (printf "\n~a\n~a\n~a\n" + (bytes-length orig) + (bytes-length filtered) + (bytes-length replaced)))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/reversecomplement-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/reversecomplement-non-optimizing.rkt new file mode 100644 index 0000000000..e9dcc8fd51 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/reversecomplement-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module reversecomplement-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/reversecomplement-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/reversecomplement-optimizing.rkt new file mode 100644 index 0000000000..004c858314 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/reversecomplement-optimizing.rkt @@ -0,0 +1,2 @@ + +(module reversecomplement-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/reversecomplement.rktl b/collects/tests/racket/benchmarks/shootout/typed/reversecomplement.rktl new file mode 100644 index 0000000000..02f1070332 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/reversecomplement.rktl @@ -0,0 +1,60 @@ +;; The Computer Language Benchmarks Game +;; http://shootout.alioth.debian.org/ + +(require scheme/cmdline) + +(define translation (make-vector 128)) + +(for: : Void + ([from-to : (List Symbol Symbol) + '([a t] + [c g] + [g c] + [t a] + [u a] + [m k] + [r y] + [w w] + [s s] + [y R] + [k M] + [v b] + [h d] + [d h] + [b v] + [n n])]) + (let ([char (lambda: ((sym : Symbol)) + (string-ref (symbol->string sym) 0))]) + (let ([from (char (car from-to))] + [to (char->integer (char-upcase (char (cadr from-to))))]) + (vector-set! translation (char->integer from) to) + (vector-set! translation (char->integer (char-upcase from)) to)))) + +(: output ((Listof Bytes) -> Void)) +(define (output lines) + (let*: ([str : Bytes (apply bytes-append lines)] + [o : Output-Port (current-output-port)] + [len : Natural (bytes-length str)]) + (for: : Void + ([offset : Natural (in-range 0 len 60)]) + (write-bytes str o offset (min len (+ offset 60))) + (newline o)))) + +(let ([in (current-input-port)]) + (let: loop : Void ([accum : (Listof Bytes) null]) + (let ([l (read-bytes-line in)]) + (if (eof-object? l) + (output accum) + (cond + [(regexp-match? #rx#"^>" l) + (output accum) + (printf "~a\n" l) + (loop null)] + [else + (let* ([len (bytes-length l)] + [dest (make-bytes len)]) + (for ([i (in-range len)]) + (bytes-set! dest + (- (- len i) 1) + (vector-ref translation (bytes-ref l i)))) + (loop (cons dest accum)))]))))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/reversefile-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/reversefile-non-optimizing.rkt new file mode 100644 index 0000000000..47b406e310 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/reversefile-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module reversefile-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/reversefile-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/reversefile-optimizing.rkt new file mode 100644 index 0000000000..cfe8108927 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/reversefile-optimizing.rkt @@ -0,0 +1,2 @@ + +(module reversefile-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/reversefile.rktl b/collects/tests/racket/benchmarks/shootout/typed/reversefile.rktl new file mode 100644 index 0000000000..7684d4328d --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/reversefile.rktl @@ -0,0 +1,12 @@ +;;; -*- mode: scheme -*- +;;; $Id: reversefile-mzscheme.code,v 1.10 2006/06/21 15:05:29 bfulgham Exp $ +;;; http://shootout.alioth.debian.org/ +;;; Provided by Bengt Kleberg + +(let ([inport (current-input-port)]) + (let: rev : Void ([lines : (Listof Bytes) null]) + (let ([line (read-bytes-line inport)]) + (if (eof-object? line) + (for-each (lambda (l) (printf "~a\n" l)) + lines) + (rev (cons line lines)))))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/run.rkt b/collects/tests/racket/benchmarks/shootout/typed/run.rkt new file mode 100644 index 0000000000..c5b136dcd4 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/run.rkt @@ -0,0 +1,128 @@ +(module run mzscheme + (require (only scheme/runtime-path define-runtime-path) + racket/port) + (define input-map + `( + ("ackermann" "11") + ("ary" "9000") + ("binarytrees" "16") + ("chameneos" "1000000") + ("cheapconcurrency" "15000") + ("echo" "150000") + ("except" "2500000") + ("fannkuch" "10") + ("fasta" "25000000") + ("fibo" "32") + ("hash" "100000") + ("hash2" "200") + ("heapsort" "100000") + ("lists" "18") + ("mandelbrot" "3000") + ("matrix" "600") + ("moments" #f ,(lambda () (mk-sumcol-input))) + ("nbody" "20000000") + ("nestedloop" "18") + ("nsieve" "9") + ("nsievebits" "11") + ("partialsums" "2500000") + ("pidigits" "2500") + ("pidigits1" "2500") + ("random" "900000") + ("recursive" "11") + ("regexmatch") + ("regexpdna" #f ,(lambda () (mk-regexpdna-input))) + ("reversecomplement" #f ,(lambda () (mk-revcomp-input))) + ("k-nucleotide" #f ,(lambda () (mk-knuc-input))) + ("reversefile" #f ,(lambda () (mk-sumcol-input))) + ("sieve" "1200") + ("spellcheck") + ("spectralnorm" "5500") + ("spectralnorm-unsafe" "5500") + ("strcat" "40000") + ("sumcol" #f ,(lambda () (mk-sumcol-input))) + ("wc" #f ,(lambda () (mk-sumcol-input))) + ("wordfreq" #f ,(lambda () (mk-sumcol-input))) + )) + + (define-runtime-path here ".") + + (define (dynreq f) + (parameterize ([current-load-relative-directory here] + [current-output-port (open-output-nowhere)]) + (dynamic-require f #f))) + + (define (mk-fasta n suffix) + (let ([f (build-path (find-system-path 'temp-dir) (string-append "fasta-" suffix))]) + (unless (file-exists? f) + (printf "Building FASTA ~a output for input: ~a\n" n f) + (with-output-to-file f + (lambda () + (parameterize ([current-command-line-arguments (vector n)]) + (dynreq "../fasta.rkt"))))) ; we can use the untyped version to generate inputs + f)) + + (define (mk-revcomp-input) + (mk-fasta "2500000" "2m5")) + + (define (mk-knuc-input) + (mk-fasta "1000000" "1m")) + + (define (mk-regexpdna-input) + (mk-fasta "5000000" "5m")) + + (define (mk-sumcol-input) + (let ([f (build-path (find-system-path 'temp-dir) "sumcol-21k")]) + (unless (file-exists? f) + (printf "Building sumcol 21000 input: ~a\n" f) + (let ([c (with-input-from-file (build-path (collection-path "tests") + "racket" + "benchmarks" + "shootout" + "sumcol-input.txt") + (lambda () + (read-bytes 10000)))]) + (with-output-to-file f + (lambda () + (let loop ([n 21000]) + (unless (zero? n) + (printf "~a" c) + (loop (sub1 n)))))))) + f)) + + (define iters + (let ([len (vector-length (current-command-line-arguments))]) + (unless (<= 2 len 3) + (printf "provide ~athe name of a benchmark on the command line, which version of the benchmark to run, and an optional iteration count\n" + (if (<= len 1) "" "ONLY ")) + (exit)) + (if (= len 3) + (string->number (vector-ref (current-command-line-arguments) 2)) + 1))) + + (let* ([version (vector-ref (current-command-line-arguments) 1)] ; racket, typed-scheme, typed-scheme-optimizing + [bench (vector-ref (current-command-line-arguments) 0)] + [prog (cond + ((string=? version "racket") (format "../~a.rkt" bench)) + ((string=? version "typed-scheme") (format "~a-non-optimizing.rkt" bench)) + ((string=? version "typed-scheme-optimizing") (format "~a-optimizing.rkt" bench)) + (else (error 'run "unknown version ~a" version)))]) + (let ([m (assoc bench input-map)]) + (unless m + (error 'run "cannot find input for ~a" bench)) + (when (null? (cdr m)) + (error 'run "don't know input for ~a" bench)) + (let loop ([n iters]) + (parameterize ([current-command-line-arguments + (if (cadr m) + (vector (cadr m)) + (vector))] + [current-input-port + (if (null? (cddr m)) + (current-input-port) + (open-input-file ((caddr m))))]) + (parameterize ([current-namespace (make-namespace)]) + (collect-garbage) + (collect-garbage) + (time (dynreq prog)))) + (unless (= n 1) + (loop (sub1 n))))))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/sieve-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/sieve-non-optimizing.rkt new file mode 100644 index 0000000000..fbf88de8a6 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/sieve-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module sieve-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/sieve-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/sieve-optimizing.rkt new file mode 100644 index 0000000000..1059133325 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/sieve-optimizing.rkt @@ -0,0 +1,2 @@ + +(module sieve-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/sieve.rktl b/collects/tests/racket/benchmarks/shootout/typed/sieve.rktl new file mode 100644 index 0000000000..c94c3c3b8b --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/sieve.rktl @@ -0,0 +1,27 @@ +(: main ((Vectorof String) -> Void)) +(define (main args) + (let: ((n : Integer + (if (= (vector-length args) 0) + 1 + (assert (string->number (vector-ref args 0)) exact-integer?))) + (count : Integer 0) + (flags : (Vectorof Boolean) (make-vector 8192 #t))) + (let loop ((iter n)) + (if (> iter 0) + (begin + (do ((i 0 (+ i 1))) ((>= i 8192)) (vector-set! flags i #t)) + (set! count 0) + (do ((i 2 (+ 1 i))) + ((>= i 8192)) + (if (vector-ref flags i) + (begin + (do ((k (+ i i) (+ k i))) + ((>= k 8192)) + (vector-set! flags k #f)) + (set! count (+ 1 count))) + #t)) + (loop (- iter 1))) + #t)) + (display "Count: ") (display count) (newline))) + +(main (current-command-line-arguments)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/spectralnorm-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/spectralnorm-non-optimizing.rkt new file mode 100644 index 0000000000..e1809b0661 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/spectralnorm-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module spectralnorm-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/spectralnorm-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/spectralnorm-optimizing.rkt new file mode 100644 index 0000000000..3fcac64e8f --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/spectralnorm-optimizing.rkt @@ -0,0 +1,2 @@ + +(module spectralnorm-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/spectralnorm.rktl b/collects/tests/racket/benchmarks/shootout/typed/spectralnorm.rktl new file mode 100644 index 0000000000..b0b8c65153 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/spectralnorm.rktl @@ -0,0 +1,65 @@ +;; The Great Computer Language Shootout +;; http://shootout.alioth.debian.org/ + +;; Translated directly from the C# version, which was: +;; contributed by Isaac Gouy + +(require racket/cmdline + racket/flonum) + +(: Approximate (Natural -> Float)) +(define (Approximate n) + (let ([u (make-flvector n 1.0)] + [v (make-flvector n 0.0)]) + ;; 20 steps of the power method + (for: : Void ([i : Integer (in-range 10)]) + (MultiplyAtAv n u v) + (MultiplyAtAv n v u)) + + ;; B=AtA A multiplied by A transposed + ;; v.Bv /(v.v) eigenvalue of v + (let loop ([i 0][vBv 0.0][vv 0.0]) + (if (= i n) + (flsqrt (fl/ vBv vv)) + (let ([vi (flvector-ref v i)]) + (loop (add1 i) + (fl+ vBv (fl* (flvector-ref u i) vi)) + (fl+ vv (fl* vi vi)))))))) + +;; return element i,j of infinite matrix A +(: A (Integer Integer -> Float)) +(define (A i j) + (fl/ 1.0 (fl+ (fl* (->fl (+ i j)) + (fl/ (->fl (+ i (+ j 1))) 2.0)) + (->fl (+ i 1))))) + +;; multiply vector v by matrix A +(: MultiplyAv (Natural FlVector FlVector -> Void)) +(define (MultiplyAv n v Av) + (for: : Void ([i : Natural (in-range n)]) + (flvector-set! Av i + (for/fold ([r 0.0]) + ([j (in-range n)]) + (fl+ r (fl* (A i j) (flvector-ref v j))))))) + +;; multiply vector v by matrix A transposed +(: MultiplyAtv (Natural FlVector FlVector -> Void)) +(define (MultiplyAtv n v Atv) + (for: : Void ([i : Natural (in-range n)]) + (flvector-set! Atv i + (for/fold ([r 0.0]) + ([j (in-range n)]) + (fl+ r (fl* (A j i) (flvector-ref v j))))))) + +;; multiply vector v by matrix A and then by matrix A transposed +(: MultiplyAtAv (Natural FlVector FlVector -> Void)) +(define (MultiplyAtAv n v AtAv) + (let ([u (make-flvector n 0.0)]) + (MultiplyAv n v u) + (MultiplyAtv n u AtAv))) + +(printf "~a\n" + (real->decimal-string + (Approximate (command-line #:args (n) (assert (string->number (assert n string?)) exact-positive-integer?))) + 9)) + diff --git a/collects/tests/racket/benchmarks/shootout/typed/spellcheck-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/spellcheck-non-optimizing.rkt new file mode 100644 index 0000000000..d898031134 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/spellcheck-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module spellcheck-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/spellcheck-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/spellcheck-optimizing.rkt new file mode 100644 index 0000000000..4386a386ca --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/spellcheck-optimizing.rkt @@ -0,0 +1,2 @@ + +(module spellcheck-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/spellcheck.rktl b/collects/tests/racket/benchmarks/shootout/typed/spellcheck.rktl new file mode 100644 index 0000000000..a965f6c806 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/spellcheck.rktl @@ -0,0 +1,23 @@ +;;; The Great Computer Language Shootout +;;; http://shootout.alioth.debian.org/ +;;; +;;; spellcheck benchmark + +(: dict (HashTable Bytes Boolean)) +(define dict (make-hash)) + +(with-input-from-file "Usr.Dict.Words" + (lambda () + (let: loop : Void () + (let ([r (read-bytes-line)]) + (unless (eof-object? r) + (hash-set! dict r #t) + (loop)))))) + +(let ([in (current-input-port)]) + (let: loop : Void () + (let ([w (read-bytes-line in)]) + (unless (eof-object? w) + (unless (hash-ref dict w (lambda () #f)) + (printf "~a\n" w)) + (loop))))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/strcat-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/strcat-non-optimizing.rkt new file mode 100644 index 0000000000..c7a183021c --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/strcat-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module strcat-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/strcat-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/strcat-optimizing.rkt new file mode 100644 index 0000000000..feb8ab5056 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/strcat-optimizing.rkt @@ -0,0 +1,2 @@ + +(module strcat-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/strcat.rktl b/collects/tests/racket/benchmarks/shootout/typed/strcat.rktl new file mode 100644 index 0000000000..987d0333ea --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/strcat.rktl @@ -0,0 +1,37 @@ +; strcat.scm + +;;; SPECIFICATION + +;For this test, each program should be implemented in the same way, +;according to the following specification. +; +; pseudocode for strcat test +; +; s is initialized to the null string +; repeat N times: +; append "hello\n" to s +; count the number of individual characters in s +; print the count + +; There should be N distinct string append statements done in a loop. +; After each append the resultant string should be 6 characters +; longer (the length of "hello\n"). +; s should be a string, string buffer, or character array. +; The program should not construct a list of strings and join it. + +(define p (open-output-bytes)) + +(define hello #"hello\n") + +(let: loop : Void + ([n : Integer + (assert (string->number + (vector-ref (current-command-line-arguments) 0)) + exact-integer?)]) + (unless (zero? n) + (display hello p) + ;; At this point, (get-output-bytes p) would + ;; return the byte string accumulated so far. + (loop (sub1 n)))) + +(printf "~a\n" (file-position p)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/sumcol-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/sumcol-non-optimizing.rkt new file mode 100644 index 0000000000..443d3f327d --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/sumcol-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module sumcol-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/sumcol-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/sumcol-optimizing.rkt new file mode 100644 index 0000000000..755ec07f7f --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/sumcol-optimizing.rkt @@ -0,0 +1,2 @@ + +(module sumcol-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/sumcol.rktl b/collects/tests/racket/benchmarks/shootout/typed/sumcol.rktl new file mode 100644 index 0000000000..d257605eb6 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/sumcol.rktl @@ -0,0 +1,4 @@ +(for/fold: : Number + ([acc : Number 0]) + ([n : String (in-lines)]) + (+ acc (assert (string->number n)))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/wc-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/wc-non-optimizing.rkt new file mode 100644 index 0000000000..1bcf0d6e0b --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/wc-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module wc-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/wc-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/wc-optimizing.rkt new file mode 100644 index 0000000000..4b4136d5d5 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/wc-optimizing.rkt @@ -0,0 +1,2 @@ + +(module wc-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/wc.rktl b/collects/tests/racket/benchmarks/shootout/typed/wc.rktl new file mode 100644 index 0000000000..d03750c65f --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/wc.rktl @@ -0,0 +1,22 @@ +; +; Faster, more idiomatic Scheme by Neil Van Dyke +; + +(: main (Input-Port -> Void)) +(define (main iport) + (apply printf "~s ~s ~s\n" + (let: wc : (Listof Natural) + ((i : Boolean #f) + (lines : Natural 0) + (words : Natural 0) + (chars : Natural 0)) + (let ((x (read-char iport))) + (if (eof-object? x) + (list lines words chars) + (case x + ((#\newline) (wc #f (add1 lines) words (add1 chars))) + ((#\space #\tab) (wc #f lines words (add1 chars))) + (else + (wc #t lines (if i words (add1 words)) (add1 chars))))))))) + +(main (current-input-port)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/wordfreq-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/wordfreq-non-optimizing.rkt new file mode 100644 index 0000000000..b8575f3e1e --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/wordfreq-non-optimizing.rkt @@ -0,0 +1,2 @@ + +(module wordfreq-non-optimizing "wrap-typed-non-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/wordfreq-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/wordfreq-optimizing.rkt new file mode 100644 index 0000000000..4b99f44204 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/wordfreq-optimizing.rkt @@ -0,0 +1,2 @@ + +(module wordfreq-optimizing "wrap-typed-optimizing.ss") diff --git a/collects/tests/racket/benchmarks/shootout/typed/wordfreq.rktl b/collects/tests/racket/benchmarks/shootout/typed/wordfreq.rktl new file mode 100644 index 0000000000..555885e448 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/wordfreq.rktl @@ -0,0 +1,35 @@ +; $Id: wordfreq-mzscheme.code,v 1.10 2006/06/21 15:05:34 bfulgham Exp $ +; http://shootout.alioth.debian.org/ +; wordfreq.mzscheme by Grzegorz Chrupaa +; Updated and corrected by Brent Fulgham +; Re-written by Matthew Flatt with some inspriation from the Python example +; Converted to Typed Scheme by Vincent St-Amour + +(require mzlib/list) + +(: t (HashTable String Natural)) +(define t (make-hash)) + +(: register-word! (Bytes -> Void)) +(define (register-word! s) + (let ([s (string-downcase (bytes->string/utf-8 s))]) + (hash-set! t s (add1 (hash-ref t s (lambda () 0)))))) + +(let ([in (current-input-port)]) + (let: loop : Void () + (let ([m (regexp-match #rx#"[a-zA-Z]+" in)]) + (when m + (register-word! (assert (car m))) + (loop))))) + +(for-each display + ((inst sort String String) + (hash-map + t + (lambda: ((word : String) (count : Natural)) + (let ((count (number->string count))) + (format"~a~a ~a~%" + (make-string (assert (- 7 (string-length count)) exact-nonnegative-integer?) #\space) + count + word)))) + string>?)) diff --git a/collects/tests/racket/benchmarks/shootout/typed/wrap-typed-non-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/wrap-typed-non-optimizing.rkt new file mode 100644 index 0000000000..79ccc456fb --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/wrap-typed-non-optimizing.rkt @@ -0,0 +1,15 @@ + +(module wrap-typed-non-optimizing racket + (provide (rename-out (module-begin #%module-begin))) + (require (lib "include.ss")) + (require (prefix-in ts: typed/scheme/base)) + (require typed/scheme/base) + (define-syntax (module-begin stx) + (let ([name (symbol->string (syntax-property stx 'enclosing-module-name))]) + #`(ts:#%module-begin + (include #,(format "~a.rktl" + (substring name + 0 + (caar (regexp-match-positions + #rx"-non-optimizing" + name))))))))) diff --git a/collects/tests/racket/benchmarks/shootout/typed/wrap-typed-optimizing.rkt b/collects/tests/racket/benchmarks/shootout/typed/wrap-typed-optimizing.rkt new file mode 100644 index 0000000000..00337d8296 --- /dev/null +++ b/collects/tests/racket/benchmarks/shootout/typed/wrap-typed-optimizing.rkt @@ -0,0 +1,15 @@ + +(module wrap-typed-optimizing racket + (provide (rename-out (module-begin #%module-begin))) + (require (lib "include.ss")) + (require (prefix-in ts: typed/scheme/base)) + (require typed/scheme/base) + (define-syntax (module-begin stx) + (let ([name (symbol->string (syntax-property stx 'enclosing-module-name))]) + #`(ts:#%module-begin #:optimize + (include #,(format "~a.rktl" + (substring name + 0 + (caar (regexp-match-positions + #rx"-optimizing" + name)))))))))