suzanne.soy/racket
1
0
Fork 0
Code Issues Pull Requests Actions Packages Projects Releases Wiki Activity

Another simple improvement, making things about twice faster.

Browse Source 
Total speedup is now ~14x.
This commit is contained in:
Eli Barzilay 2010-06-20 18:24:44 -04:00
parent 26c89b2ac6
commit c78f367d9f
1 changed files with 13 additions and 3 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

16
collects/tests/racket/benchmarks/shootout/fasta.rkt
View File

@ -7,8 +7,11 @@
;;
;; Very loosely based on the Chicken variant by Anthony Borla, some
;; optimizations taken from the GCC version by Petr Prokhorenkov, and
;; additional optimizations by Eli Barzilay (not really related to the
;; above two now).
;; additional heavy optimizations by Eli Barzilay (not really related to
;; the above two now).
;;
;; If you use some of these optimizations in other solutions, please
;; include a proper attribution to this Racket code.
(define +alu+
(bytes-append #"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
@ -59,7 +62,14 @@
(define IM 139968)
(define IM.0 (fx->fl IM))
(define (random-next cur) (fxmodulo (fx+ IC (fx* cur IA)) IM))
(define-syntax-rule (define/IM (name id) E)
(begin (define V
(let ([v (make-vector IM)])
(for ([id (in-range IM)]) (vector-set! v id E))
v))
(define-syntax-rule (name id) (vector-ref V id))))
(define/IM (random-next cur) (fxmodulo (fx+ IC (fx* cur IA)) IM))
(define (make-lookup-table frequency-table)
(define v (make-bytes IM))