suzanne.soy/racket
1
0
Fork 0
Code Issues Pull Requests Actions Packages Projects Releases Wiki Activity

collect benchmark programs together in one place, finally

Browse Source 
svn: r3848
This commit is contained in:
Matthew Flatt 2006-07-27 19:32:22 +00:00
parent 611ca37285
commit d615bccb08
88 changed files with 13390 additions and 0 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

8
collects/tests/mzscheme/benchmarks/common/README.txt Normal file
View File

@ -0,0 +1,8 @@
Bechmarks obtained from
http://www.cs.cmu.edu/afs/cs/project/ai-repository/ai/lang/scheme/code/bench/gabriel/
http://www.ccs.neu.edu/home/will/GC/sourcecode.html
Files that end in ".sch" are supposed to be standard Scheme plus `time'.
Files that end in ".ss" are MzScheme wrapper modules.
Unpack "dynamic-input.txt.gz" if you want to run the "dynamic" benchmark.

179
collects/tests/mzscheme/benchmarks/common/browse.sch Normal file
View File

@ -0,0 +1,179 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: browse.sch
; Description: The BROWSE benchmark from the Gabriel tests
; Author: Richard Gabriel
; Created: 8-Apr-85
; Modified: 14-Jun-85 18:44:49 (Bob Shaw)
; 16-Aug-87 (Will Clinger)
; 22-Jan-88 (Will Clinger)
; Language: Scheme (but see notes below)
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; Note: This benchmark has been run only in implementations in which
; the empty list is the same as #f, and may not work if that is not true.
; Note: This benchmark uses property lists. The procedures that must
; be supplied are get and put, where (put x y z) is equivalent to Common
; Lisp's (setf (get x y) z).
; Note: The Common Lisp version assumes that eq works on characters,
; which is not a portable assumption but is true in most implementations.
; This translation makes the same assumption about eq?.
; Note: The gensym procedure was left as in Common Lisp. Most Scheme
; implementations have something similar internally.
; Note: The original benchmark took the car or cdr of the empty list
; 14,600 times. Before explicit tests were added to protect the offending
; calls to car and cdr, MacScheme was spending a quarter of its run time
; in the exception handler recovering from those errors.
; The next few definitions should be omitted if the Scheme implementation
; already provides them.
(module browse mzscheme
(define (my-append! x y)
(if (null? x)
y
(do ((a x b)
(b (cdr x) (cdr b)))
((null? b)
(set-cdr! a y)
x))))
(define (copy-tree x)
(if (not (pair? x))
x
(cons (copy-tree (car x))
(copy-tree (cdr x)))))
;;; BROWSE -- Benchmark to create and browse through
;;; an AI-like data base of units.
;;; n is # of symbols
;;; m is maximum amount of stuff on the plist
;;; npats is the number of basic patterns on the unit
;;; ipats is the instantiated copies of the patterns
(define *rand* 21)
(define (init n m npats ipats)
(let ((ipats (copy-tree ipats)))
(do ((p ipats (cdr p)))
((null? (cdr p)) (set-cdr! p ipats)))
(do ((n n (- n 1))
(i m (cond ((zero? i) m)
(else (- i 1))))
(name (gensym) (gensym))
(a #f))
((= n 0) a)
(set! a (cons name a))
(do ((i i (- i 1)))
((zero? i))
(put name (gensym) #f))
(put name
'pattern
(do ((i npats (- i 1))
(ipats ipats (cdr ipats))
(a '()))
((zero? i) a)
(set! a (cons (car ipats) a))))
(do ((j (- m i) (- j 1)))
((zero? j))
(put name (gensym) #f)))))
(define (browse-random)
(set! *rand* (remainder (* *rand* 17) 251))
*rand*)
(define (randomize l)
(do ((a '()))
((null? l) a)
(let ((n (remainder (browse-random) (length l))))
(cond ((zero? n)
(set! a (cons (car l) a))
(set! l (cdr l))
l)
(else
(do ((n n (- n 1))
(x l (cdr x)))
((= n 1)
(set! a (cons (cadr x) a))
(set-cdr! x (cddr x))
x)))))))
(define (match pat dat alist)
(cond ((null? pat)
(null? dat))
((null? dat) '())
((or (eq? (car pat) '?)
(eq? (car pat)
(car dat)))
(match (cdr pat) (cdr dat) alist))
((eq? (car pat) '*)
(or (match (cdr pat) dat alist)
(match (cdr pat) (cdr dat) alist)
(match pat (cdr dat) alist)))
(else (cond ((not (pair? (car pat)))
(cond ((eq? (string-ref (symbol->string (car pat)) 0)
#\?)
(let ((val (assv (car pat) alist)))
(cond (val (match (cons (cdr val)
(cdr pat))
dat alist))
(else (match (cdr pat)
(cdr dat)
(cons (cons (car pat)
(car dat))
alist))))))
((eq? (string-ref (symbol->string (car pat)) 0)
#\*)
(let ((val (assv (car pat) alist)))
(cond (val (match (append (cdr val)
(cdr pat))
dat alist))
(else
(do ((l '()
(my-append! l
(cons (if (null? d)
'()
(car d))
'())))
(e (cons '() dat) (cdr e))
(d dat (if (null? d) '() (cdr d))))
((or (null? e)
(match (cdr pat)
d
(cons
(cons (car pat) l)
alist)))
(if (null? e) #f #t)))))))))
(else (and
(pair? (car dat))
(match (car pat)
(car dat) alist)
(match (cdr pat)
(cdr dat) alist)))))))
(define (browse)
(investigate
(randomize
(init 100 10 4 '((a a a b b b b a a a a a b b a a a)
(a a b b b b a a
(a a)(b b))
(a a a b (b a) b a b a))))
'((*a ?b *b ?b a *a a *b *a)
(*a *b *b *a (*a) (*b))
(? ? * (b a) * ? ?))))
(define (investigate units pats)
(do ((units units (cdr units)))
((null? units))
(do ((pats pats (cdr pats)))
((null? pats))
(do ((p (get (car units) 'pattern)
(cdr p)))
((null? p))
(match (car pats) (car p) '())))))
(time (browse))
)

619
collects/tests/mzscheme/benchmarks/common/conform.sch Normal file
View File

@ -0,0 +1,619 @@
;
; conform.scm [portable/R^399RS version]
; By Jim Miller [mods by oz]
; [call to run-benchmark added by wdc 14 Feb 1997]
; (declare (usual-integrations))
;; SORT
(define (vector-copy v)
(let* ((length (vector-length v))
(result (make-vector length)))
(let loop ((n 0))
(vector-set! result n (vector-ref v n))
(if (= n length)
v
(loop (+ n 1))))))
(define (sort obj pred)
(define (loop l)
(if (and (pair? l) (pair? (cdr l)))
(split l '() '())
l))
(define (split l one two)
(if (pair? l)
(split (cdr l) two (cons (car l) one))
(merge (loop one) (loop two))))
(define (merge one two)
(cond ((null? one) two)
((pred (car two) (car one))
(cons (car two)
(merge (cdr two) one)))
(else
(cons (car one)
(merge (cdr one) two)))))
(cond ((or (pair? obj) (null? obj))
(loop obj))
((vector? obj)
(sort! (vector-copy obj) pred))
(else
(error "sort: argument should be a list or vector" obj))))
;; This merge sort is stable for partial orders (for predicates like
;; <=, rather than like <).
(define (sort! v pred)
(define (sort-internal! vec temp low high)
(if (< low high)
(let* ((middle (quotient (+ low high) 2))
(next (+ middle 1)))
(sort-internal! temp vec low middle)
(sort-internal! temp vec next high)
(let loop ((p low) (p1 low) (p2 next))
(if (not (> p high))
(cond ((> p1 middle)
(vector-set! vec p (vector-ref temp p2))
(loop (+ p 1) p1 (+ p2 1)))
((or (> p2 high)
(pred (vector-ref temp p1)
(vector-ref temp p2)))
(vector-set! vec p (vector-ref temp p1))
(loop (+ p 1) (+ p1 1) p2))
(else
(vector-set! vec p (vector-ref temp p2))
(loop (+ p 1) p1 (+ p2 1)))))))))
(if (not (vector? v))
(error "sort!: argument not a vector" v))
(sort-internal! v
(vector-copy v)
0
(- (vector-length v) 1))
v)
;; SET OPERATIONS
; (representation as lists with distinct elements)
(define (adjoin element set)
(if (memq element set) set (cons element set)))
(define (eliminate element set)
(cond ((null? set) set)
((eq? element (car set)) (cdr set))
(else (cons (car set) (eliminate element (cdr set))))))
(define (intersect list1 list2)
(let loop ((l list1))
(cond ((null? l) '())
((memq (car l) list2) (cons (car l) (loop (cdr l))))
(else (loop (cdr l))))))
(define (union list1 list2)
(if (null? list1)
list2
(union (cdr list1)
(adjoin (car list1) list2))))
;; GRAPH NODES
; (define-structure
; (internal-node
; (print-procedure (unparser/standard-method
; 'graph-node
; (lambda (state node)
; (unparse-object state (internal-node-name node))))))
; name
; (green-edges '())
; (red-edges '())
; blue-edges)
; Above is MIT version; below is portable
(define make-internal-node vector)
(define (internal-node-name node) (vector-ref node 0))
(define (internal-node-green-edges node) (vector-ref node 1))
(define (internal-node-red-edges node) (vector-ref node 2))
(define (internal-node-blue-edges node) (vector-ref node 3))
(define (set-internal-node-name! node name) (vector-set! node 0 name))
(define (set-internal-node-green-edges! node edges) (vector-set! node 1 edges))
(define (set-internal-node-red-edges! node edges) (vector-set! node 2 edges))
(define (set-internal-node-blue-edges! node edges) (vector-set! node 3 edges))
; End of portability stuff
(define (make-node name . blue-edges) ; User's constructor
(let ((name (if (symbol? name) (symbol->string name) name))
(blue-edges (if (null? blue-edges) 'NOT-A-NODE-YET (car blue-edges))))
(make-internal-node name '() '() blue-edges)))
(define (copy-node node)
(make-internal-node (name node) '() '() (blue-edges node)))
; Selectors
(define name internal-node-name)
(define (make-edge-getter selector)
(lambda (node)
(if (or (none-node? node) (any-node? node))
(error "Can't get edges from the ANY or NONE nodes")
(selector node))))
(define red-edges (make-edge-getter internal-node-red-edges))
(define green-edges (make-edge-getter internal-node-green-edges))
(define blue-edges (make-edge-getter internal-node-blue-edges))
; Mutators
(define (make-edge-setter mutator!)
(lambda (node value)
(cond ((any-node? node) (error "Can't set edges from the ANY node"))
((none-node? node) 'OK)
(else (mutator! node value)))))
(define set-red-edges! (make-edge-setter set-internal-node-red-edges!))
(define set-green-edges! (make-edge-setter set-internal-node-green-edges!))
(define set-blue-edges! (make-edge-setter set-internal-node-blue-edges!))
;; BLUE EDGES
; (define-structure
; (blue-edge
; (print-procedure
; (unparser/standard-method
; 'blue-edge
; (lambda (state edge)
; (unparse-object state (blue-edge-operation edge))))))
; operation arg-node res-node)
; Above is MIT version; below is portable
(define make-blue-edge vector)
(define (blue-edge-operation edge) (vector-ref edge 0))
(define (blue-edge-arg-node edge) (vector-ref edge 1))
(define (blue-edge-res-node edge) (vector-ref edge 2))
(define (set-blue-edge-operation! edge value) (vector-set! edge 0 value))
(define (set-blue-edge-arg-node! edge value) (vector-set! edge 1 value))
(define (set-blue-edge-res-node! edge value) (vector-set! edge 2 value))
; End of portability stuff
; Selectors
(define operation blue-edge-operation)
(define arg-node blue-edge-arg-node)
(define res-node blue-edge-res-node)
; Mutators
(define set-arg-node! set-blue-edge-arg-node!)
(define set-res-node! set-blue-edge-res-node!)
; Higher level operations on blue edges
(define (lookup-op op node)
(let loop ((edges (blue-edges node)))
(cond ((null? edges) '())
((eq? op (operation (car edges))) (car edges))
(else (loop (cdr edges))))))
(define (has-op? op node)
(not (null? (lookup-op op node))))
; Add a (new) blue edge to a node
; (define (adjoin-blue-edge! blue-edge node)
; (let ((current-one (lookup-op (operation blue-edge) node)))
; (cond ((null? current-one)
; (set-blue-edges! node
; (cons blue-edge (blue-edges node))))
; ((and (eq? (arg-node current-one) (arg-node blue-edge))
; (eq? (res-node current-one) (res-node blue-edge)))
; 'OK)
; (else (error "Two non-equivalent blue edges for op"
; blue-edge node)))))
;; GRAPHS
; (define-structure
; (internal-graph
; (print-procedure
; (unparser/standard-method 'graph
; (lambda (state edge)
; (unparse-object state (map name (internal-graph-nodes edge)))))))
; nodes already-met already-joined)
; Above is MIT version; below is portable
(define make-internal-graph vector)
(define (internal-graph-nodes graph) (vector-ref graph 0))
(define (internal-graph-already-met graph) (vector-ref graph 1))
(define (internal-graph-already-joined graph) (vector-ref graph 2))
(define (set-internal-graph-nodes! graph nodes) (vector-set! graph 0 nodes))
; End of portability stuff
; Constructor
(define (make-graph . nodes)
(make-internal-graph nodes (make-empty-table) (make-empty-table)))
; Selectors
(define graph-nodes internal-graph-nodes)
(define already-met internal-graph-already-met)
(define already-joined internal-graph-already-joined)
; Higher level functions on graphs
(define (add-graph-nodes! graph nodes)
(set-internal-graph-nodes! graph (cons nodes (graph-nodes graph))))
(define (copy-graph g)
(define (copy-list l) (vector->list (list->vector l)))
(make-internal-graph
(copy-list (graph-nodes g))
(already-met g)
(already-joined g)))
(define (clean-graph g)
(define (clean-node node)
(if (not (or (any-node? node) (none-node? node)))
(begin
(set-green-edges! node '())
(set-red-edges! node '()))))
(for-each clean-node (graph-nodes g))
g)
(define (canonicalize-graph graph classes)
(define (fix node)
(define (fix-set object selector mutator)
(mutator object
(map (lambda (node)
(find-canonical-representative node classes))
(selector object))))
(if (not (or (none-node? node) (any-node? node)))
(begin
(fix-set node green-edges set-green-edges!)
(fix-set node red-edges set-red-edges!)
(for-each
(lambda (blue-edge)
(set-arg-node! blue-edge
(find-canonical-representative (arg-node blue-edge) classes))
(set-res-node! blue-edge
(find-canonical-representative (res-node blue-edge) classes)))
(blue-edges node))))
node)
(define (fix-table table)
(define (canonical? node) (eq? node (find-canonical-representative node classes)))
(define (filter-and-fix predicate-fn update-fn list)
(let loop ((list list))
(cond ((null? list) '())
((predicate-fn (car list))
(cons (update-fn (car list)) (loop (cdr list))))
(else (loop (cdr list))))))
(define (fix-line line)
(filter-and-fix
(lambda (entry) (canonical? (car entry)))
(lambda (entry) (cons (car entry)
(find-canonical-representative (cdr entry) classes)))
line))
(if (null? table)
'()
(cons (car table)
(filter-and-fix
(lambda (entry) (canonical? (car entry)))
(lambda (entry) (cons (car entry) (fix-line (cdr entry))))
(cdr table)))))
(make-internal-graph
(map (lambda (class) (fix (car class))) classes)
(fix-table (already-met graph))
(fix-table (already-joined graph))))
;; USEFUL NODES
(define none-node (make-node 'none #t))
(define (none-node? node) (eq? node none-node))
(define any-node (make-node 'any '()))
(define (any-node? node) (eq? node any-node))
;; COLORED EDGE TESTS
(define (green-edge? from-node to-node)
(cond ((any-node? from-node) #f)
((none-node? from-node) #t)
((memq to-node (green-edges from-node)) #t)
(else #f)))
(define (red-edge? from-node to-node)
(cond ((any-node? from-node) #f)
((none-node? from-node) #t)
((memq to-node (red-edges from-node)) #t)
(else #f)))
;; SIGNATURE
; Return signature (i.e. <arg, res>) given an operation and a node
(define sig
(let ((none-comma-any (cons none-node any-node)))
(lambda (op node) ; Returns (arg, res)
(let ((the-edge (lookup-op op node)))
(if (not (null? the-edge))
(cons (arg-node the-edge) (res-node the-edge))
none-comma-any)))))
; Selectors from signature
(define (arg pair) (car pair))
(define (res pair) (cdr pair))
;; CONFORMITY
(define (conforms? t1 t2)
(define nodes-with-red-edges-out '())
(define (add-red-edge! from-node to-node)
(set-red-edges! from-node (adjoin to-node (red-edges from-node)))
(set! nodes-with-red-edges-out
(adjoin from-node nodes-with-red-edges-out)))
(define (greenify-red-edges! from-node)
(set-green-edges! from-node
(append (red-edges from-node) (green-edges from-node)))
(set-red-edges! from-node '()))
(define (delete-red-edges! from-node)
(set-red-edges! from-node '()))
(define (does-conform t1 t2)
(cond ((or (none-node? t1) (any-node? t2)) #t)
((or (any-node? t1) (none-node? t2)) #f)
((green-edge? t1 t2) #t)
((red-edge? t1 t2) #t)
(else
(add-red-edge! t1 t2)
(let loop ((blues (blue-edges t2)))
(if (null? blues)
#t
(let* ((current-edge (car blues))
(phi (operation current-edge)))
(and (has-op? phi t1)
(does-conform
(res (sig phi t1))
(res (sig phi t2)))
(does-conform
(arg (sig phi t2))
(arg (sig phi t1)))
(loop (cdr blues)))))))))
(let ((result (does-conform t1 t2)))
(for-each (if result greenify-red-edges! delete-red-edges!)
nodes-with-red-edges-out)
result))
(define (equivalent? a b)
(and (conforms? a b) (conforms? b a)))
;; EQUIVALENCE CLASSIFICATION
; Given a list of nodes, return a list of equivalence classes
(define (classify nodes)
(let node-loop ((classes '())
(nodes nodes))
(if (null? nodes)
(map (lambda (class)
(sort class
(lambda (node1 node2)
(< (string-length (name node1))
(string-length (name node2))))))
classes)
(let ((this-node (car nodes)))
(define (add-node classes)
(cond ((null? classes) (list (list this-node)))
((equivalent? this-node (caar classes))
(cons (cons this-node (car classes))
(cdr classes)))
(else (cons (car classes)
(add-node (cdr classes))))))
(node-loop (add-node classes)
(cdr nodes))))))
; Given a node N and a classified set of nodes,
; find the canonical member corresponding to N
(define (find-canonical-representative element classification)
(let loop ((classes classification))
(cond ((null? classes) (error "Can't classify" element))
((memq element (car classes)) (car (car classes)))
(else (loop (cdr classes))))))
; Reduce a graph by taking only one member of each equivalence
; class and canonicalizing all outbound pointers
(define (reduce graph)
(let ((classes (classify (graph-nodes graph))))
(canonicalize-graph graph classes)))
;; TWO DIMENSIONAL TABLES
(define (make-empty-table) (list 'TABLE))
(define (lookup table x y)
(let ((one (assq x (cdr table))))
(if one
(let ((two (assq y (cdr one))))
(if two (cdr two) #f))
#f)))
(define (insert! table x y value)
(define (make-singleton-table x y)
(list (cons x y)))
(let ((one (assq x (cdr table))))
(if one
(set-cdr! one (cons (cons y value) (cdr one)))
(set-cdr! table (cons (cons x (make-singleton-table y value))
(cdr table))))))
;; MEET/JOIN
; These update the graph when computing the node for node1*node2
(define (blue-edge-operate arg-fn res-fn graph op sig1 sig2)
(make-blue-edge op
(arg-fn graph (arg sig1) (arg sig2))
(res-fn graph (res sig1) (res sig2))))
(define (meet graph node1 node2)
(cond ((eq? node1 node2) node1)
((or (any-node? node1) (any-node? node2)) any-node) ; canonicalize
((none-node? node1) node2)
((none-node? node2) node1)
((lookup (already-met graph) node1 node2)) ; return it if found
((conforms? node1 node2) node2)
((conforms? node2 node1) node1)
(else
(let ((result
(make-node (string-append "(" (name node1) " ^ " (name node2) ")"))))
(add-graph-nodes! graph result)
(insert! (already-met graph) node1 node2 result)
(set-blue-edges! result
(map
(lambda (op)
(blue-edge-operate join meet graph op (sig op node1) (sig op node2)))
(intersect (map operation (blue-edges node1))
(map operation (blue-edges node2)))))
result))))
(define (join graph node1 node2)
(cond ((eq? node1 node2) node1)
((any-node? node1) node2)
((any-node? node2) node1)
((or (none-node? node1) (none-node? node2)) none-node) ; canonicalize
((lookup (already-joined graph) node1 node2)) ; return it if found
((conforms? node1 node2) node1)
((conforms? node2 node1) node2)
(else
(let ((result
(make-node (string-append "(" (name node1) " v " (name node2) ")"))))
(add-graph-nodes! graph result)
(insert! (already-joined graph) node1 node2 result)
(set-blue-edges! result
(map
(lambda (op)
(blue-edge-operate meet join graph op (sig op node1) (sig op node2)))
(union (map operation (blue-edges node1))
(map operation (blue-edges node2)))))
result))))
;; MAKE A LATTICE FROM A GRAPH
(define (make-lattice g print?)
(define (step g)
(let* ((copy (copy-graph g))
(nodes (graph-nodes copy)))
(for-each (lambda (first)
(for-each (lambda (second)
(meet copy first second)
(join copy first second))
nodes))
nodes)
copy))
(define (loop g count)
(if print? (display count))
(let ((lattice (step g)))
(if print? (begin (display " -> ")
(display (length (graph-nodes lattice)))))
(let* ((new-g (reduce lattice))
(new-count (length (graph-nodes new-g))))
(if (= new-count count)
(begin
(if print? (newline))
new-g)
(begin
(if print? (begin (display " -> ")
(display new-count) (newline)))
(loop new-g new-count))))))
(let ((graph
(apply make-graph
(adjoin any-node (adjoin none-node (graph-nodes (clean-graph g)))))))
(loop graph (length (graph-nodes graph)))))
;; DEBUG and TEST
(define a '())
(define b '())
(define c '())
(define d '())
(define (reset)
(set! a (make-node 'a))
(set! b (make-node 'b))
(set-blue-edges! a (list (make-blue-edge 'phi any-node b)))
(set-blue-edges! b (list (make-blue-edge 'phi any-node a)
(make-blue-edge 'theta any-node b)))
(set! c (make-node "c"))
(set! d (make-node "d"))
(set-blue-edges! c (list (make-blue-edge 'theta any-node b)))
(set-blue-edges! d (list (make-blue-edge 'phi any-node c)
(make-blue-edge 'theta any-node d)))
'(made a b c d))
(define (test)
(reset)
(map name
(graph-nodes
(make-lattice (make-graph a b c d any-node none-node) #t))))
;;; note printflag #t
;(define (time-test)
; (let ((t (runtime)))
; (let ((ans (test)))
; (cons ans (- (runtime) t)))))
;
; run and make sure result is correct
;
(define (go)
(reset)
(let ((result '("(((b v d) ^ a) v c)"
"(c ^ d)"
"(b v (a ^ d))"
"((a v d) ^ b)"
"(b v d)"
"(b ^ (a v c))"
"(a v (c ^ d))"
"((b v d) ^ a)"
"(c v (a v d))"
"(a v c)"
"(d v (b ^ (a v c)))"
"(d ^ (a v c))"
"((a ^ d) v c)"
"((a ^ b) v d)"
"(((a v d) ^ b) v (a ^ d))"
"(b ^ d)"
"(b v (a v d))"
"(a ^ c)"
"(b ^ (c v d))"
"(a ^ b)"
"(a v b)"
"((a ^ d) ^ b)"
"(a ^ d)"
"(a v d)"
"d"
"(c v d)"
"a"
"b"
"c"
"any"
"none")))
(if (equal? (test) result)
(display " ok.")
(display " um."))
(newline)))
;[mods made by wdc]
;(go)
;(exit)
(define (conform-benchmark . rest)
(time (go)))
(conform-benchmark)

2
collects/tests/mzscheme/benchmarks/common/conform.ss Normal file
View File

@ -0,0 +1,2 @@
(module conform "wrap.ss")

34
collects/tests/mzscheme/benchmarks/common/cpstack.sch Normal file
View File

@ -0,0 +1,34 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: cpstak.sch
; Description: continuation-passing version of TAK
; Author: Will Clinger
; Created: 20-Aug-87
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;; CPSTAK -- A continuation-passing version of the TAK benchmark.
;;; A good test of first class procedures and tail recursion.
(define (cpstak x y z)
(define (tak x y z k)
(if (not (< y x))
(k z)
(tak (- x 1)
y
z
(lambda (v1)
(tak (- y 1)
z
x
(lambda (v2)
(tak (- z 1)
x
y
(lambda (v3)
(tak v1 v2 v3 k)))))))))
(tak x y z (lambda (a) a)))
;;; call: (cpstak 18 12 6)
(time (cpstak 18 12 2))

2
collects/tests/mzscheme/benchmarks/common/cpstack.ss Normal file
View File

@ -0,0 +1,2 @@
(module cpstack "wrap.ss")

55
collects/tests/mzscheme/benchmarks/common/ctak.sch Normal file
View File

@ -0,0 +1,55 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: ctak.sch
; Description: The ctak benchmark
; Author: Richard Gabriel
; Created: 5-Apr-85
; Modified: 10-Apr-85 14:53:02 (Bob Shaw)
; 24-Jul-87 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; The original version of this benchmark used a continuation mechanism that
; is less powerful than call-with-current-continuation and also relied on
; dynamic binding, which is not provided in standard Scheme. Since the
; intent of the benchmark seemed to be to test non-local exits, the dynamic
; binding has been replaced here by lexical binding.
; For Scheme the comment that follows should read:
;;; CTAK -- A version of the TAK procedure that uses continuations.
;;; CTAK -- A version of the TAK function that uses the CATCH/THROW facility.
(define (ctak x y z)
(call-with-current-continuation
(lambda (k)
(ctak-aux k x y z))))
(define (ctak-aux k x y z)
(cond ((not (< y x)) ;xy
(k z))
(else (call-with-current-continuation
(ctak-aux
k
(call-with-current-continuation
(lambda (k)
(ctak-aux k
(- x 1)
y
z)))
(call-with-current-continuation
(lambda (k)
(ctak-aux k
(- y 1)
z
x)))
(call-with-current-continuation
(lambda (k)
(ctak-aux k
(- z 1)
x
y))))))))
;;; call: (ctak 18 12 6)
(time (ctak 18 12 6))

2
collects/tests/mzscheme/benchmarks/common/ctak.ss Normal file
View File

@ -0,0 +1,2 @@
(module ctak "wrap.ss")

99
collects/tests/mzscheme/benchmarks/common/dderiv.ss Normal file
View File

@ -0,0 +1,99 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: dderiv.sch
; Description: DDERIV benchmark from the Gabriel tests
; Author: Vaughan Pratt
; Created: 8-Apr-85
; Modified: 10-Apr-85 14:53:29 (Bob Shaw)
; 23-Jul-87 (Will Clinger)
; 9-Feb-88 (Will Clinger)
; Language: Scheme (but see note below)
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; Note: This benchmark uses property lists. The procedures that must
; be supplied are get and put, where (put x y z) is equivalent to Common
; Lisp's (setf (get x y) z).
;;; DDERIV -- Symbolic derivative benchmark written by Vaughn Pratt.
;;; This benchmark is a variant of the simple symbolic derivative program
;;; (DERIV). The main change is that it is `table-driven.' Instead of using a
;;; large COND that branches on the CAR of the expression, this program finds
;;; the code that will take the derivative on the property list of the atom in
;;; the CAR position. So, when the expression is (+ . <rest>), the code
;;; stored under the atom '+ with indicator DERIV will take <rest> and
;;; return the derivative for '+. The way that MacLisp does this is with the
;;; special form: (DEFUN (FOO BAR) ...). This is exactly like DEFUN with an
;;; atomic name in that it expects an argument list and the compiler compiles
;;; code, but the name of the function with that code is stored on the
;;; property list of FOO under the indicator BAR, in this case. You may have
;;; to do something like:
;;; :property keyword is not Common Lisp.
; Returns the wrong answer for quotients.
; Fortunately these aren't used in the benchmark.
(module dderiv mzscheme
(define pg-alist '())
(define (put sym d what)
(set! pg-alist (cons (cons sym what) pg-alist)))
(define (get sym d)
(cdr (assq sym pg-alist)))
(define (dderiv-aux a)
(list '/ (dderiv a) a))
(define (+dderiv a)
(cons '+ (map dderiv a)))
(put '+ 'dderiv +dderiv) ; install procedure on the property list
(define (-dderiv a)
(cons '- (map dderiv a)))
(put '- 'dderiv -dderiv) ; install procedure on the property list
(define (*dderiv a)
(list '* (cons '* a)
(cons '+ (map dderiv-aux a))))
(put '* 'dderiv *dderiv) ; install procedure on the property list
(define (/dderiv a)
(list '-
(list '/
(dderiv (car a))
(cadr a))
(list '/
(car a)
(list '*
(cadr a)
(cadr a)
(dderiv (cadr a))))))
(put '/ 'dderiv /dderiv) ; install procedure on the property list
(define (dderiv a)
(cond
((not (pair? a))
(cond ((eq? a 'x) 1) (else 0)))
(else (let ((dderiv (get (car a) 'dderiv)))
(cond (dderiv (dderiv (cdr a)))
(else 'error))))))
(define (run)
(do ((i 0 (+ i 1)))
((= i 10000))
(dderiv '(+ (* 3 x x) (* a x x) (* b x) 5))
(dderiv '(+ (* 3 x x) (* a x x) (* b x) 5))
(dderiv '(+ (* 3 x x) (* a x x) (* b x) 5))
(dderiv '(+ (* 3 x x) (* a x x) (* b x) 5))
(dderiv '(+ (* 3 x x) (* a x x) (* b x) 5))))
;;; call: (run)
(time (run))
)

59
collects/tests/mzscheme/benchmarks/common/deriv.sch Normal file
View File

@ -0,0 +1,59 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: deriv.sch
; Description: The DERIV benchmark from the Gabriel tests.
; Author: Vaughan Pratt
; Created: 8-Apr-85
; Modified: 10-Apr-85 14:53:50 (Bob Shaw)
; 23-Jul-87 (Will Clinger)
; 9-Feb-88 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;; DERIV -- Symbolic derivative benchmark written by Vaughn Pratt.
;;; It uses a simple subset of Lisp and does a lot of CONSing.
; Returns the wrong answer for quotients.
; Fortunately these aren't used in the benchmark.
(define (deriv-aux a) (list '/ (deriv a) a))
(define (deriv a)
(cond
((not (pair? a))
(cond ((eq? a 'x) 1) (else 0)))
((eq? (car a) '+)
(cons '+ (map deriv (cdr a))))
((eq? (car a) '-)
(cons '- (map deriv
(cdr a))))
((eq? (car a) '*)
(list '*
a
(cons '+ (map deriv-aux (cdr a)))))
((eq? (car a) '/)
(list '-
(list '/
(deriv (cadr a))
(caddr a))
(list '/
(cadr a)
(list '*
(caddr a)
(caddr a)
(deriv (caddr a))))))
(else 'error)))
(define (run)
(do ((i 0 (+ i 1)))
((= i 10000))
(deriv '(+ (* 3 x x) (* a x x) (* b x) 5))
(deriv '(+ (* 3 x x) (* a x x) (* b x) 5))
(deriv '(+ (* 3 x x) (* a x x) (* b x) 5))
(deriv '(+ (* 3 x x) (* a x x) (* b x) 5))
(deriv '(+ (* 3 x x) (* a x x) (* b x) 5))))
;;; call: (run)
(time (run))

2
collects/tests/mzscheme/benchmarks/common/deriv.ss Normal file
View File

@ -0,0 +1,2 @@
(module deriv "wrap.ss")

64
collects/tests/mzscheme/benchmarks/common/destruct.sch Normal file
View File

@ -0,0 +1,64 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: destruct.sch
; Description: DESTRUCTIVE benchmark from Gabriel tests
; Author: Bob Shaw, HPLabs/ATC
; Created: 8-Apr-85
; Modified: 10-Apr-85 14:54:12 (Bob Shaw)
; 23-Jul-87 (Will Clinger)
; 22-Jan-88 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; append! is no longer a standard Scheme procedure, so it must be defined
; for implementations that don't already have it.
(define (my-append! x y)
(if (null? x)
y
(do ((a x b)
(b (cdr x) (cdr b)))
((null? b)
(set-cdr! a y)
x))))
;;; DESTRU -- Destructive operation benchmark
(define (destructive n m)
(let ((l (do ((i 10 (- i 1))
(a '() (cons '() a)))
((= i 0) a))))
(do ((i n (- i 1)))
((= i 0))
(cond ((null? (car l))
(do ((l l (cdr l)))
((null? l))
(or (car l)
(set-car! l (cons '() '())))
(my-append! (car l)
(do ((j m (- j 1))
(a '() (cons '() a)))
((= j 0) a)))))
(else
(do ((l1 l (cdr l1))
(l2 (cdr l) (cdr l2)))
((null? l2))
(set-cdr! (do ((j (quotient (length (car l2)) 2) (- j 1))
(a (car l2) (cdr a)))
((zero? j) a)
(set-car! a i))
(let ((n (quotient (length (car l1)) 2)))
(cond ((= n 0) (set-car! l1 '())
(car l1))
(else
(do ((j n (- j 1))
(a (car l1) (cdr a)))
((= j 1)
(let ((x (cdr a)))
(set-cdr! a '())
x))
(set-car! a i))))))))))))
;;; call: (destructive 600 50)
(time (destructive 600 500))

2
collects/tests/mzscheme/benchmarks/common/destruct.ss Normal file
View File

@ -0,0 +1,2 @@
(module destruct "wrap.ss")

54
collects/tests/mzscheme/benchmarks/common/div.ss Normal file
View File

@ -0,0 +1,54 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: div.sch
; Description: DIV benchmarks
; Author: Richard Gabriel
; Created: 8-Apr-85
; Modified: 19-Jul-85 18:28:01 (Bob Shaw)
; 23-Jul-87 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;; DIV2 -- Benchmark which divides by 2 using lists of n ()'s.
;;; This file contains a recursive as well as an iterative test.
(module div mzscheme
(define (create-n n)
(do ((n n (- n 1))
(a '() (cons '() a)))
((= n 0) a)))
(define *ll* (create-n 200))
(define (iterative-div2 l)
(do ((l l (cddr l))
(a '() (cons (car l) a)))
((null? l) a)))
(define (recursive-div2 l)
(cond ((null? l) '())
(else (cons (car l) (recursive-div2 (cddr l))))))
(define (test-1 l)
(do ((i 3000 (- i 1)))
((= i 0))
(iterative-div2 l)
(iterative-div2 l)
(iterative-div2 l)
(iterative-div2 l)))
(define (test-2 l)
(do ((i 3000 (- i 1)))
((= i 0))
(recursive-div2 l)
(recursive-div2 l)
(recursive-div2 l)
(recursive-div2 l)))
;;; for the iterative test call: (test-1 *ll*)
;;; for the recursive test call: (test-2 *ll*)
(time (test-1 *ll*))
(time (test-2 *ll*))
)

BIN
collects/tests/mzscheme/benchmarks/common/dynamic-input.txt.gz Normal file
View File

Binary file not shown.

2340
collects/tests/mzscheme/benchmarks/common/dynamic.sch Normal file
View File

File diff suppressed because it is too large Load Diff

2
collects/tests/mzscheme/benchmarks/common/dynamic.ss Normal file
View File

@ -0,0 +1,2 @@
(module dynamic "wrap.ss")

650
collects/tests/mzscheme/benchmarks/common/earley.sch Normal file
View File

@ -0,0 +1,650 @@
;;; EARLEY -- Earley's parser, written by Marc Feeley.
; $Id: earley.sch,v 1.2 1999/07/12 18:05:19 lth Exp $
; 990708 / lth -- changed 'main' to 'earley-benchmark'.
;
; (make-parser grammar lexer) is used to create a parser from the grammar
; description `grammar' and the lexer function `lexer'.
;
; A grammar is a list of definitions. Each definition defines a non-terminal
; by a set of rules. Thus a definition has the form: (nt rule1 rule2...).
; A given non-terminal can only be defined once. The first non-terminal
; defined is the grammar's goal. Each rule is a possibly empty list of
; non-terminals. Thus a rule has the form: (nt1 nt2...). A non-terminal
; can be any scheme value. Note that all grammar symbols are treated as
; non-terminals. This is fine though because the lexer will be outputing
; non-terminals.
;
; The lexer defines what a token is and the mapping between tokens and
; the grammar's non-terminals. It is a function of one argument, the input,
; that returns the list of tokens corresponding to the input. Each token is
; represented by a list. The first element is some `user-defined' information
; associated with the token and the rest represents the token's class(es) (as a
; list of non-terminals that this token corresponds to).
;
; The result of `make-parser' is a function that parses the single input it
; is given into the grammar's goal. The result is a `parse' which can be
; manipulated with the procedures: `parse->parsed?', `parse->trees'
; and `parse->nb-trees' (see below).
;
; Let's assume that we want a parser for the grammar
;
; S -> x = E
; E -> E + E | V
; V -> V y |
;
; and that the input to the parser is a string of characters. Also, assume we
; would like to map the characters `x', `y', `+' and `=' into the corresponding
; non-terminals in the grammar. Such a parser could be created with
;
; (make-parser
; '(
; (s (x = e))
; (e (e + e) (v))
; (v (v y) ())
; )
; (lambda (str)
; (map (lambda (char)
; (list char ; user-info = the character itself
; (case char
; ((#\x) 'x)
; ((#\y) 'y)
; ((#\+) '+)
; ((#\=) '=)
; (else (fatal-error "lexer error")))))
; (string->list str)))
; )
;
; An alternative definition (that does not check for lexical errors) is
;
; (make-parser
; '(
; (s (#\x #\= e))
; (e (e #\+ e) (v))
; (v (v #\y) ())
; )
; (lambda (str) (map (lambda (char) (list char char)) (string->list str)))
; )
;
; To help with the rest of the discussion, here are a few definitions:
;
; An input pointer (for an input of `n' tokens) is a value between 0 and `n'.
; It indicates a point between two input tokens (0 = beginning, `n' = end).
; For example, if `n' = 4, there are 5 input pointers:
;
; input token1 token2 token3 token4
; input pointers 0 1 2 3 4
;
; A configuration indicates the extent to which a given rule is parsed (this
; is the common `dot notation'). For simplicity, a configuration is
; represented as an integer, with successive configurations in the same
; rule associated with successive integers. It is assumed that the grammar
; has been extended with rules to aid scanning. These rules are of the
; form `nt ->', and there is one such rule for every non-terminal. Note
; that these rules are special because they only apply when the corresponding
; non-terminal is returned by the lexer.
;
; A configuration set is a configuration grouped with the set of input pointers
; representing where the head non-terminal of the configuration was predicted.
;
; Here are the rules and configurations for the grammar given above:
;
; S -> . \
; 0 |
; x -> . |
; 1 |
; = -> . |
; 2 |
; E -> . |
; 3 > special rules (for scanning)
; + -> . |
; 4 |
; V -> . |
; 5 |
; y -> . |
; 6 /
; S -> . x . = . E .
; 7 8 9 10
; E -> . E . + . E .
; 11 12 13 14
; E -> . V .
; 15 16
; V -> . V . y .
; 17 18 19
; V -> .
; 20
;
; Starters of the non-terminal `nt' are configurations that are leftmost
; in a non-special rule for `nt'. Enders of the non-terminal `nt' are
; configurations that are rightmost in any rule for `nt'. Predictors of the
; non-terminal `nt' are configurations that are directly to the left of `nt'
; in any rule.
;
; For the grammar given above,
;
; Starters of V = (17 20)
; Enders of V = (5 19 20)
; Predictors of V = (15 17)
(define (make-parser grammar lexer)
(define (non-terminals grammar) ; return vector of non-terminals in grammar
(define (add-nt nt nts)
(if (member nt nts) nts (cons nt nts))) ; use equal? for equality tests
(let def-loop ((defs grammar) (nts '()))
(if (pair? defs)
(let* ((def (car defs))
(head (car def)))
(let rule-loop ((rules (cdr def))
(nts (add-nt head nts)))
(if (pair? rules)
(let ((rule (car rules)))
(let loop ((l rule) (nts nts))
(if (pair? l)
(let ((nt (car l)))
(loop (cdr l) (add-nt nt nts)))
(rule-loop (cdr rules) nts))))
(def-loop (cdr defs) nts))))
(list->vector (reverse nts))))) ; goal non-terminal must be at index 0
(define (ind nt nts) ; return index of non-terminal `nt' in `nts'
(let loop ((i (- (vector-length nts) 1)))
(if (>= i 0)
(if (equal? (vector-ref nts i) nt) i (loop (- i 1)))
#f)))
(define (nb-configurations grammar) ; return nb of configurations in grammar
(let def-loop ((defs grammar) (nb-confs 0))
(if (pair? defs)
(let ((def (car defs)))
(let rule-loop ((rules (cdr def)) (nb-confs nb-confs))
(if (pair? rules)
(let ((rule (car rules)))
(let loop ((l rule) (nb-confs nb-confs))
(if (pair? l)
(loop (cdr l) (+ nb-confs 1))
(rule-loop (cdr rules) (+ nb-confs 1)))))
(def-loop (cdr defs) nb-confs))))
nb-confs)))
; First, associate a numeric identifier to every non-terminal in the
; grammar (with the goal non-terminal associated with 0).
;
; So, for the grammar given above we get:
;
; s -> 0 x -> 1 = -> 4 e ->3 + -> 4 v -> 5 y -> 6
(let* ((nts (non-terminals grammar)) ; id map = list of non-terms
(nb-nts (vector-length nts)) ; the number of non-terms
(nb-confs (+ (nb-configurations grammar) nb-nts)) ; the nb of confs
(starters (make-vector nb-nts '())) ; starters for every non-term
(enders (make-vector nb-nts '())) ; enders for every non-term
(predictors (make-vector nb-nts '())) ; predictors for every non-term
(steps (make-vector nb-confs #f)) ; what to do in a given conf
(names (make-vector nb-confs #f))) ; name of rules
(define (setup-tables grammar nts starters enders predictors steps names)
(define (add-conf conf nt nts class)
(let ((i (ind nt nts)))
(vector-set! class i (cons conf (vector-ref class i)))))
(let ((nb-nts (vector-length nts)))
(let nt-loop ((i (- nb-nts 1)))
(if (>= i 0)
(begin
(vector-set! steps i (- i nb-nts))
(vector-set! names i (list (vector-ref nts i) 0))
(vector-set! enders i (list i))
(nt-loop (- i 1)))))
(let def-loop ((defs grammar) (conf (vector-length nts)))
(if (pair? defs)
(let* ((def (car defs))
(head (car def)))
(let rule-loop ((rules (cdr def)) (conf conf) (rule-num 1))
(if (pair? rules)
(let ((rule (car rules)))
(vector-set! names conf (list head rule-num))
(add-conf conf head nts starters)
(let loop ((l rule) (conf conf))
(if (pair? l)
(let ((nt (car l)))
(vector-set! steps conf (ind nt nts))
(add-conf conf nt nts predictors)
(loop (cdr l) (+ conf 1)))
(begin
(vector-set! steps conf (- (ind head nts) nb-nts))
(add-conf conf head nts enders)
(rule-loop (cdr rules) (+ conf 1) (+ rule-num 1))))))
(def-loop (cdr defs) conf))))))))
; Now, for each non-terminal, compute the starters, enders and predictors and
; the names and steps tables.
(setup-tables grammar nts starters enders predictors steps names)
; Build the parser description
(let ((parser-descr (vector lexer
nts
starters
enders
predictors
steps
names)))
(lambda (input)
(define (ind nt nts) ; return index of non-terminal `nt' in `nts'
(let loop ((i (- (vector-length nts) 1)))
(if (>= i 0)
(if (equal? (vector-ref nts i) nt) i (loop (- i 1)))
#f)))
(define (comp-tok tok nts) ; transform token to parsing format
(let loop ((l1 (cdr tok)) (l2 '()))
(if (pair? l1)
(let ((i (ind (car l1) nts)))
(if i
(loop (cdr l1) (cons i l2))
(loop (cdr l1) l2)))
(cons (car tok) (reverse l2)))))
(define (input->tokens input lexer nts)
(list->vector (map (lambda (tok) (comp-tok tok nts)) (lexer input))))
(define (make-states nb-toks nb-confs)
(let ((states (make-vector (+ nb-toks 1) #f)))
(let loop ((i nb-toks))
(if (>= i 0)
(let ((v (make-vector (+ nb-confs 1) #f)))
(vector-set! v 0 -1)
(vector-set! states i v)
(loop (- i 1)))
states))))
(define (conf-set-get state conf)
(vector-ref state (+ conf 1)))
(define (conf-set-get* state state-num conf)
(let ((conf-set (conf-set-get state conf)))
(if conf-set
conf-set
(let ((conf-set (make-vector (+ state-num 6) #f)))
(vector-set! conf-set 1 -3) ; old elems tail (points to head)
(vector-set! conf-set 2 -1) ; old elems head
(vector-set! conf-set 3 -1) ; new elems tail (points to head)
(vector-set! conf-set 4 -1) ; new elems head
(vector-set! state (+ conf 1) conf-set)
conf-set))))
(define (conf-set-merge-new! conf-set)
(vector-set! conf-set
(+ (vector-ref conf-set 1) 5)
(vector-ref conf-set 4))
(vector-set! conf-set 1 (vector-ref conf-set 3))
(vector-set! conf-set 3 -1)
(vector-set! conf-set 4 -1))
(define (conf-set-head conf-set)
(vector-ref conf-set 2))
(define (conf-set-next conf-set i)
(vector-ref conf-set (+ i 5)))
(define (conf-set-member? state conf i)
(let ((conf-set (vector-ref state (+ conf 1))))
(if conf-set
(conf-set-next conf-set i)
#f)))
(define (conf-set-adjoin state conf-set conf i)
(let ((tail (vector-ref conf-set 3))) ; put new element at tail
(vector-set! conf-set (+ i 5) -1)
(vector-set! conf-set (+ tail 5) i)
(vector-set! conf-set 3 i)
(if (< tail 0)
(begin
(vector-set! conf-set 0 (vector-ref state 0))
(vector-set! state 0 conf)))))
(define (conf-set-adjoin* states state-num l i)
(let ((state (vector-ref states state-num)))
(let loop ((l1 l))
(if (pair? l1)
(let* ((conf (car l1))
(conf-set (conf-set-get* state state-num conf)))
(if (not (conf-set-next conf-set i))
(begin
(conf-set-adjoin state conf-set conf i)
(loop (cdr l1)))
(loop (cdr l1))))))))
(define (conf-set-adjoin** states states* state-num conf i)
(let ((state (vector-ref states state-num)))
(if (conf-set-member? state conf i)
(let* ((state* (vector-ref states* state-num))
(conf-set* (conf-set-get* state* state-num conf)))
(if (not (conf-set-next conf-set* i))
(conf-set-adjoin state* conf-set* conf i))
#t)
#f)))
(define (conf-set-union state conf-set conf other-set)
(let loop ((i (conf-set-head other-set)))
(if (>= i 0)
(if (not (conf-set-next conf-set i))
(begin
(conf-set-adjoin state conf-set conf i)
(loop (conf-set-next other-set i)))
(loop (conf-set-next other-set i))))))
(define (forw states state-num starters enders predictors steps nts)
(define (predict state state-num conf-set conf nt starters enders)
; add configurations which start the non-terminal `nt' to the
; right of the dot
(let loop1 ((l (vector-ref starters nt)))
(if (pair? l)
(let* ((starter (car l))
(starter-set (conf-set-get* state state-num starter)))
(if (not (conf-set-next starter-set state-num))
(begin
(conf-set-adjoin state starter-set starter state-num)
(loop1 (cdr l)))
(loop1 (cdr l))))))
; check for possible completion of the non-terminal `nt' to the
; right of the dot
(let loop2 ((l (vector-ref enders nt)))
(if (pair? l)
(let ((ender (car l)))
(if (conf-set-member? state ender state-num)
(let* ((next (+ conf 1))
(next-set (conf-set-get* state state-num next)))
(conf-set-union state next-set next conf-set)
(loop2 (cdr l)))
(loop2 (cdr l)))))))
(define (reduce states state state-num conf-set head preds)
; a non-terminal is now completed so check for reductions that
; are now possible at the configurations `preds'
(let loop1 ((l preds))
(if (pair? l)
(let ((pred (car l)))
(let loop2 ((i head))
(if (>= i 0)
(let ((pred-set (conf-set-get (vector-ref states i) pred)))
(if pred-set
(let* ((next (+ pred 1))
(next-set (conf-set-get* state state-num next)))
(conf-set-union state next-set next pred-set)))
(loop2 (conf-set-next conf-set i)))
(loop1 (cdr l))))))))
(let ((state (vector-ref states state-num))
(nb-nts (vector-length nts)))
(let loop ()
(let ((conf (vector-ref state 0)))
(if (>= conf 0)
(let* ((step (vector-ref steps conf))
(conf-set (vector-ref state (+ conf 1)))
(head (vector-ref conf-set 4)))
(vector-set! state 0 (vector-ref conf-set 0))
(conf-set-merge-new! conf-set)
(if (>= step 0)
(predict state state-num conf-set conf step starters enders)
(let ((preds (vector-ref predictors (+ step nb-nts))))
(reduce states state state-num conf-set head preds)))
(loop)))))))
(define (forward starters enders predictors steps nts toks)
(let* ((nb-toks (vector-length toks))
(nb-confs (vector-length steps))
(states (make-states nb-toks nb-confs))
(goal-starters (vector-ref starters 0)))
(conf-set-adjoin* states 0 goal-starters 0) ; predict goal
(forw states 0 starters enders predictors steps nts)
(let loop ((i 0))
(if (< i nb-toks)
(let ((tok-nts (cdr (vector-ref toks i))))
(conf-set-adjoin* states (+ i 1) tok-nts i) ; scan token
(forw states (+ i 1) starters enders predictors steps nts)
(loop (+ i 1)))))
states))
(define (produce conf i j enders steps toks states states* nb-nts)
(let ((prev (- conf 1)))
(if (and (>= conf nb-nts) (>= (vector-ref steps prev) 0))
(let loop1 ((l (vector-ref enders (vector-ref steps prev))))
(if (pair? l)
(let* ((ender (car l))
(ender-set (conf-set-get (vector-ref states j)
ender)))
(if ender-set
(let loop2 ((k (conf-set-head ender-set)))
(if (>= k 0)
(begin
(and (>= k i)
(conf-set-adjoin** states states* k prev i)
(conf-set-adjoin** states states* j ender k))
(loop2 (conf-set-next ender-set k)))
(loop1 (cdr l))))
(loop1 (cdr l)))))))))
(define (back states states* state-num enders steps nb-nts toks)
(let ((state* (vector-ref states* state-num)))
(let loop1 ()
(let ((conf (vector-ref state* 0)))
(if (>= conf 0)
(let* ((conf-set (vector-ref state* (+ conf 1)))
(head (vector-ref conf-set 4)))
(vector-set! state* 0 (vector-ref conf-set 0))
(conf-set-merge-new! conf-set)
(let loop2 ((i head))
(if (>= i 0)
(begin
(produce conf i state-num enders steps
toks states states* nb-nts)
(loop2 (conf-set-next conf-set i)))
(loop1)))))))))
(define (backward states enders steps nts toks)
(let* ((nb-toks (vector-length toks))
(nb-confs (vector-length steps))
(nb-nts (vector-length nts))
(states* (make-states nb-toks nb-confs))
(goal-enders (vector-ref enders 0)))
(let loop1 ((l goal-enders))
(if (pair? l)
(let ((conf (car l)))
(conf-set-adjoin** states states* nb-toks conf 0)
(loop1 (cdr l)))))
(let loop2 ((i nb-toks))
(if (>= i 0)
(begin
(back states states* i enders steps nb-nts toks)
(loop2 (- i 1)))))
states*))
(define (parsed? nt i j nts enders states)
(let ((nt* (ind nt nts)))
(if nt*
(let ((nb-nts (vector-length nts)))
(let loop ((l (vector-ref enders nt*)))
(if (pair? l)
(let ((conf (car l)))
(if (conf-set-member? (vector-ref states j) conf i)
#t
(loop (cdr l))))
#f)))
#f)))
(define (deriv-trees conf i j enders steps names toks states nb-nts)
(let ((name (vector-ref names conf)))
(if name ; `conf' is at the start of a rule (either special or not)
(if (< conf nb-nts)
(list (list name (car (vector-ref toks i))))
(list (list name)))
(let ((prev (- conf 1)))
(let loop1 ((l1 (vector-ref enders (vector-ref steps prev)))
(l2 '()))
(if (pair? l1)
(let* ((ender (car l1))
(ender-set (conf-set-get (vector-ref states j)
ender)))
(if ender-set
(let loop2 ((k (conf-set-head ender-set)) (l2 l2))
(if (>= k 0)
(if (and (>= k i)
(conf-set-member? (vector-ref states k)
prev i))
(let ((prev-trees
(deriv-trees prev i k enders steps names
toks states nb-nts))
(ender-trees
(deriv-trees ender k j enders steps names
toks states nb-nts)))
(let loop3 ((l3 ender-trees) (l2 l2))
(if (pair? l3)
(let ((ender-tree (list (car l3))))
(let loop4 ((l4 prev-trees) (l2 l2))
(if (pair? l4)
(loop4 (cdr l4)
(cons (append (car l4)
ender-tree)
l2))
(loop3 (cdr l3) l2))))
(loop2 (conf-set-next ender-set k) l2))))
(loop2 (conf-set-next ender-set k) l2))
(loop1 (cdr l1) l2)))
(loop1 (cdr l1) l2)))
l2))))))
(define (deriv-trees* nt i j nts enders steps names toks states)
(let ((nt* (ind nt nts)))
(if nt*
(let ((nb-nts (vector-length nts)))
(let loop ((l (vector-ref enders nt*)) (trees '()))
(if (pair? l)
(let ((conf (car l)))
(if (conf-set-member? (vector-ref states j) conf i)
(loop (cdr l)
(append (deriv-trees conf i j enders steps names
toks states nb-nts)
trees))
(loop (cdr l) trees)))
trees)))
#f)))
(define (nb-deriv-trees conf i j enders steps toks states nb-nts)
(let ((prev (- conf 1)))
(if (or (< conf nb-nts) (< (vector-ref steps prev) 0))
1
(let loop1 ((l (vector-ref enders (vector-ref steps prev)))
(n 0))
(if (pair? l)
(let* ((ender (car l))
(ender-set (conf-set-get (vector-ref states j)
ender)))
(if ender-set
(let loop2 ((k (conf-set-head ender-set)) (n n))
(if (>= k 0)
(if (and (>= k i)
(conf-set-member? (vector-ref states k)
prev i))
(let ((nb-prev-trees
(nb-deriv-trees prev i k enders steps
toks states nb-nts))
(nb-ender-trees
(nb-deriv-trees ender k j enders steps
toks states nb-nts)))
(loop2 (conf-set-next ender-set k)
(+ n (* nb-prev-trees nb-ender-trees))))
(loop2 (conf-set-next ender-set k) n))
(loop1 (cdr l) n)))
(loop1 (cdr l) n)))
n)))))
(define (nb-deriv-trees* nt i j nts enders steps toks states)
(let ((nt* (ind nt nts)))
(if nt*
(let ((nb-nts (vector-length nts)))
(let loop ((l (vector-ref enders nt*)) (nb-trees 0))
(if (pair? l)
(let ((conf (car l)))
(if (conf-set-member? (vector-ref states j) conf i)
(loop (cdr l)
(+ (nb-deriv-trees conf i j enders steps
toks states nb-nts)
nb-trees))
(loop (cdr l) nb-trees)))
nb-trees)))
#f)))
(let* ((lexer (vector-ref parser-descr 0))
(nts (vector-ref parser-descr 1))
(starters (vector-ref parser-descr 2))
(enders (vector-ref parser-descr 3))
(predictors (vector-ref parser-descr 4))
(steps (vector-ref parser-descr 5))
(names (vector-ref parser-descr 6))
(toks (input->tokens input lexer nts)))
(vector nts
starters
enders
predictors
steps
names
toks
(backward (forward starters enders predictors steps nts toks)
enders steps nts toks)
parsed?
deriv-trees*
nb-deriv-trees*))))))
(define (parse->parsed? parse nt i j)
(let* ((nts (vector-ref parse 0))
(enders (vector-ref parse 2))
(states (vector-ref parse 7))
(parsed? (vector-ref parse 8)))
(parsed? nt i j nts enders states)))
(define (parse->trees parse nt i j)
(let* ((nts (vector-ref parse 0))
(enders (vector-ref parse 2))
(steps (vector-ref parse 4))
(names (vector-ref parse 5))
(toks (vector-ref parse 6))
(states (vector-ref parse 7))
(deriv-trees* (vector-ref parse 9)))
(deriv-trees* nt i j nts enders steps names toks states)))
(define (parse->nb-trees parse nt i j)
(let* ((nts (vector-ref parse 0))
(enders (vector-ref parse 2))
(steps (vector-ref parse 4))
(toks (vector-ref parse 6))
(states (vector-ref parse 7))
(nb-deriv-trees* (vector-ref parse 10)))
(nb-deriv-trees* nt i j nts enders steps toks states)))
(define (test k)
(let ((p (make-parser '( (s (a) (s s)) )
(lambda (l) (map (lambda (x) (list x x)) l)))))
(let ((x (p (vector->list (make-vector k 'a)))))
(length (parse->trees x 's 0 k)))))
(time (test 12))

2
collects/tests/mzscheme/benchmarks/common/earley.ss Normal file
View File

@ -0,0 +1,2 @@
(module earley "wrap.ss")

117
collects/tests/mzscheme/benchmarks/common/fft.sch Normal file
View File

@ -0,0 +1,117 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: fft.cl
; Description: FFT benchmark from the Gabriel tests.
; Author: Harry Barrow
; Created: 8-Apr-85
; Modified: 6-May-85 09:29:22 (Bob Shaw)
; 11-Aug-87 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
(define pi (atan 0 -1))
;;; FFT -- This is an FFT benchmark written by Harry Barrow.
;;; It tests a variety of floating point operations,
;;; including array references.
(define *re* (make-vector 1025 0.0))
(define *im* (make-vector 1025 0.0))
(define (fft areal aimag)
(let ((ar 0)
(ai 0)
(i 0)
(j 0)
(k 0)
(m 0)
(n 0)
(le 0)
(le1 0)
(ip 0)
(nv2 0)
(nm1 0)
(ur 0)
(ui 0)
(wr 0)
(wi 0)
(tr 0)
(ti 0))
;; initialize
(set! ar areal)
(set! ai aimag)
(set! n (vector-length ar))
(set! n (- n 1))
(set! nv2 (quotient n 2))
(set! nm1 (- n 1))
(set! m 0) ;compute m = log(n)
(set! i 1)
(let loop ()
(if (< i n)
(begin (set! m (+ m 1))
(set! i (+ i i))
(loop))))
(cond ((not (= n (expt 2 m)))
(error "array size not a power of two.")))
;; interchange elements in bit-reversed order
(set! j 1)
(set! i 1)
(let l3 ()
(cond ((< i j)
(set! tr (vector-ref ar j))
(set! ti (vector-ref ai j))
(vector-set! ar j (vector-ref ar i))
(vector-set! ai j (vector-ref ai i))
(vector-set! ar i tr)
(vector-set! ai i ti)))
(set! k nv2)
(let l6 ()
(cond ((< k j)
(set! j (- j k))
(set! k (/ k 2))
(l6))))
(set! j (+ j k))
(set! i (+ i 1))
(cond ((< i n)
(l3))))
(do ((l 1 (+ l 1))) ;loop thru stages (syntax converted
((> l m)) ; from old MACLISP style \bs)
(set! le (expt 2 l))
(set! le1 (quotient le 2))
(set! ur 1.0)
(set! ui 0.)
(set! wr (cos (/ pi le1)))
(set! wi (sin (/ pi le1)))
;; loop thru butterflies
(do ((j 1 (+ j 1)))
((> j le1))
;; do a butterfly
(do ((i j (+ i le)))
((> i n))
(set! ip (+ i le1))
(set! tr (- (* (vector-ref ar ip) ur)
(* (vector-ref ai ip) ui)))
(set! ti (+ (* (vector-ref ar ip) ui)
(* (vector-ref ai ip) ur)))
(vector-set! ar ip (- (vector-ref ar i) tr))
(vector-set! ai ip (- (vector-ref ai i) ti))
(vector-set! ar i (+ (vector-ref ar i) tr))
(vector-set! ai i (+ (vector-ref ai i) ti))))
(set! tr (- (* ur wr) (* ui wi)))
(set! ti (+ (* ur wi) (* ui wr)))
(set! ur tr)
(set! ui ti))
#t))
;;; the timer which does 10 calls on fft
(define (fft-bench)
(do ((ntimes 0 (+ ntimes 1)))
((= ntimes 1000))
(fft *re* *im*)))
;;; call: (fft-bench)
(time (fft-bench))

2
collects/tests/mzscheme/benchmarks/common/fft.ss Normal file
View File

@ -0,0 +1,2 @@
(module fft "wrap.ss")

645
collects/tests/mzscheme/benchmarks/common/graphs.sch Normal file
View File

@ -0,0 +1,645 @@
; Modified 2 March 1997 by Will Clinger to add graphs-benchmark
; and to expand the four macros below.
; Modified 11 June 1997 by Will Clinger to eliminate assertions
; and to replace a use of "recur" with a named let.
;
; Performance note: (graphs-benchmark 7) allocates
; 34509143 pairs
; 389625 vectors with 2551590 elements
; 56653504 closures (not counting top level and known procedures)
(define (graphs-benchmark . rest)
(let ((N (if (null? rest) 7 (car rest))))
(time
(fold-over-rdg N
2
cons
'()))))
; End of new code.
;;; ==== std.ss ====
; (define-syntax assert
; (syntax-rules ()
; ((assert test info-rest ...)
; #F)))
;
; (define-syntax deny
; (syntax-rules ()
; ((deny test info-rest ...)
; #F)))
;
; (define-syntax when
; (syntax-rules ()
; ((when test e-first e-rest ...)
; (if test
; (begin e-first
; e-rest ...)))))
;
; (define-syntax unless
; (syntax-rules ()
; ((unless test e-first e-rest ...)
; (if (not test)
; (begin e-first
; e-rest ...)))))
(define assert
(lambda (test . info)
#f))
;;; ==== util.ss ====
; Fold over list elements, associating to the left.
(define fold
(lambda (lst folder state)
'(assert (list? lst)
lst)
'(assert (procedure? folder)
folder)
(do ((lst lst
(cdr lst))
(state state
(folder (car lst)
state)))
((null? lst)
state))))
; Given the size of a vector and a procedure which
; sends indicies to desired vector elements, create
; and return the vector.
(define proc->vector
(lambda (size f)
'(assert (and (integer? size)
(exact? size)
(>= size 0))
size)
'(assert (procedure? f)
f)
(if (zero? size)
(vector)
(let ((x (make-vector size (f 0))))
(let loop ((i 1))
(if (< i size) (begin ; [wdc - was when]
(vector-set! x i (f i))
(loop (+ i 1)))))
x))))
(define vector-fold
(lambda (vec folder state)
'(assert (vector? vec)
vec)
'(assert (procedure? folder)
folder)
(let ((len
(vector-length vec)))
(do ((i 0
(+ i 1))
(state state
(folder (vector-ref vec i)
state)))
((= i len)
state)))))
(define vector-map
(lambda (vec proc)
(proc->vector (vector-length vec)
(lambda (i)
(proc (vector-ref vec i))))))
; Given limit, return the list 0, 1, ..., limit-1.
(define giota
(lambda (limit)
'(assert (and (integer? limit)
(exact? limit)
(>= limit 0))
limit)
(let -*-
((limit
limit)
(res
'()))
(if (zero? limit)
res
(let ((limit
(- limit 1)))
(-*- limit
(cons limit res)))))))
; Fold over the integers [0, limit).
(define gnatural-fold
(lambda (limit folder state)
'(assert (and (integer? limit)
(exact? limit)
(>= limit 0))
limit)
'(assert (procedure? folder)
folder)
(do ((i 0
(+ i 1))
(state state
(folder i state)))
((= i limit)
state))))
; Iterate over the integers [0, limit).
(define gnatural-for-each
(lambda (limit proc!)
'(assert (and (integer? limit)
(exact? limit)
(>= limit 0))
limit)
'(assert (procedure? proc!)
proc!)
(do ((i 0
(+ i 1)))
((= i limit))
(proc! i))))
(define natural-for-all?
(lambda (limit ok?)
'(assert (and (integer? limit)
(exact? limit)
(>= limit 0))
limit)
'(assert (procedure? ok?)
ok?)
(let -*-
((i 0))
(or (= i limit)
(and (ok? i)
(-*- (+ i 1)))))))
(define natural-there-exists?
(lambda (limit ok?)
'(assert (and (integer? limit)
(exact? limit)
(>= limit 0))
limit)
'(assert (procedure? ok?)
ok?)
(let -*-
((i 0))
(and (not (= i limit))
(or (ok? i)
(-*- (+ i 1)))))))
(define there-exists?
(lambda (lst ok?)
'(assert (list? lst)
lst)
'(assert (procedure? ok?)
ok?)
(let -*-
((lst lst))
(and (not (null? lst))
(or (ok? (car lst))
(-*- (cdr lst)))))))
;;; ==== ptfold.ss ====
; Fold over the tree of permutations of a universe.
; Each branch (from the root) is a permutation of universe.
; Each node at depth d corresponds to all permutations which pick the
; elements spelled out on the branch from the root to that node as
; the first d elements.
; Their are two components to the state:
; The b-state is only a function of the branch from the root.
; The t-state is a function of all nodes seen so far.
; At each node, b-folder is called via
; (b-folder elem b-state t-state deeper accross)
; where elem is the next element of the universe picked.
; If b-folder can determine the result of the total tree fold at this stage,
; it should simply return the result.
; If b-folder can determine the result of folding over the sub-tree
; rooted at the resulting node, it should call accross via
; (accross new-t-state)
; where new-t-state is that result.
; Otherwise, b-folder should call deeper via
; (deeper new-b-state new-t-state)
; where new-b-state is the b-state for the new node and new-t-state is
; the new folded t-state.
; At the leaves of the tree, t-folder is called via
; (t-folder b-state t-state accross)
; If t-folder can determine the result of the total tree fold at this stage,
; it should simply return that result.
; If not, it should call accross via
; (accross new-t-state)
; Note, fold-over-perm-tree always calls b-folder in depth-first order.
; I.e., when b-folder is called at depth d, the branch leading to that
; node is the most recent calls to b-folder at all the depths less than d.
; This is a gross efficiency hack so that b-folder can use mutation to
; keep the current branch.
(define fold-over-perm-tree
(lambda (universe b-folder b-state t-folder t-state)
'(assert (list? universe)
universe)
'(assert (procedure? b-folder)
b-folder)
'(assert (procedure? t-folder)
t-folder)
(let -*-
((universe
universe)
(b-state
b-state)
(t-state
t-state)
(accross
(lambda (final-t-state)
final-t-state)))
(if (null? universe)
(t-folder b-state t-state accross)
(let -**-
((in
universe)
(out
'())
(t-state
t-state))
(let* ((first
(car in))
(rest
(cdr in))
(accross
(if (null? rest)
accross
(lambda (new-t-state)
(-**- rest
(cons first out)
new-t-state)))))
(b-folder first
b-state
t-state
(lambda (new-b-state new-t-state)
(-*- (fold out cons rest)
new-b-state
new-t-state
accross))
accross)))))))
;;; ==== minimal.ss ====
; A directed graph is stored as a connection matrix (vector-of-vectors)
; where the first index is the `from' vertex and the second is the `to'
; vertex. Each entry is a bool indicating if the edge exists.
; The diagonal of the matrix is never examined.
; Make-minimal? returns a procedure which tests if a labelling
; of the verticies is such that the matrix is minimal.
; If it is, then the procedure returns the result of folding over
; the elements of the automoriphism group. If not, it returns #F.
; The folding is done by calling folder via
; (folder perm state accross)
; If the folder wants to continue, it should call accross via
; (accross new-state)
; If it just wants the entire minimal? procedure to return something,
; it should return that.
; The ordering used is lexicographic (with #T > #F) and entries
; are examined in the following order:
; 1->0, 0->1
;
; 2->0, 0->2
; 2->1, 1->2
;
; 3->0, 0->3
; 3->1, 1->3
; 3->2, 2->3
; ...
(define make-minimal?
(lambda (max-size)
'(assert (and (integer? max-size)
(exact? max-size)
(>= max-size 0))
max-size)
(let ((iotas
(proc->vector (+ max-size 1)
giota))
(perm
(make-vector max-size 0)))
(lambda (size graph folder state)
'(assert (and (integer? size)
(exact? size)
(<= 0 size max-size))
size
max-size)
'(assert (vector? graph)
graph)
'(assert (procedure? folder)
folder)
(fold-over-perm-tree (vector-ref iotas size)
(lambda (perm-x x state deeper accross)
(case (cmp-next-vertex graph perm x perm-x)
((less)
#F)
((equal)
(vector-set! perm x perm-x)
(deeper (+ x 1)
state))
((more)
(accross state))
(else
(assert #F))))
0
(lambda (leaf-depth state accross)
'(assert (eqv? leaf-depth size)
leaf-depth
size)
(folder perm state accross))
state)))))
; Given a graph, a partial permutation vector, the next input and the next
; output, return 'less, 'equal or 'more depending on the lexicographic
; comparison between the permuted and un-permuted graph.
(define cmp-next-vertex
(lambda (graph perm x perm-x)
(let ((from-x
(vector-ref graph x))
(from-perm-x
(vector-ref graph perm-x)))
(let -*-
((y
0))
(if (= x y)
'equal
(let ((x->y?
(vector-ref from-x y))
(perm-y
(vector-ref perm y)))
(cond ((eq? x->y?
(vector-ref from-perm-x perm-y))
(let ((y->x?
(vector-ref (vector-ref graph y)
x)))
(cond ((eq? y->x?
(vector-ref (vector-ref graph perm-y)
perm-x))
(-*- (+ y 1)))
(y->x?
'less)
(else
'more))))
(x->y?
'less)
(else
'more))))))))
;;; ==== rdg.ss ====
; Fold over rooted directed graphs with bounded out-degree.
; Size is the number of verticies (including the root). Max-out is the
; maximum out-degree for any vertex. Folder is called via
; (folder edges state)
; where edges is a list of length size. The ith element of the list is
; a list of the verticies j for which there is an edge from i to j.
; The last vertex is the root.
(define fold-over-rdg
(lambda (size max-out folder state)
'(assert (and (exact? size)
(integer? size)
(> size 0))
size)
'(assert (and (exact? max-out)
(integer? max-out)
(>= max-out 0))
max-out)
'(assert (procedure? folder)
folder)
(let* ((root
(- size 1))
(edge?
(proc->vector size
(lambda (from)
(make-vector size #F))))
(edges
(make-vector size '()))
(out-degrees
(make-vector size 0))
(minimal-folder
(make-minimal? root))
(non-root-minimal?
(let ((cont
(lambda (perm state accross)
'(assert (eq? state #T)
state)
(accross #T))))
(lambda (size)
(minimal-folder size
edge?
cont
#T))))
(root-minimal?
(let ((cont
(lambda (perm state accross)
'(assert (eq? state #T)
state)
(case (cmp-next-vertex edge? perm root root)
((less)
#F)
((equal more)
(accross #T))
(else
(assert #F))))))
(lambda ()
(minimal-folder root
edge?
cont
#T)))))
(let -*-
((vertex
0)
(state
state))
(cond ((not (non-root-minimal? vertex))
state)
((= vertex root)
'(assert
(begin
(gnatural-for-each root
(lambda (v)
'(assert (= (vector-ref out-degrees v)
(length (vector-ref edges v)))
v
(vector-ref out-degrees v)
(vector-ref edges v))))
#T))
(let ((reach?
(make-reach? root edges))
(from-root
(vector-ref edge? root)))
(let -*-
((v
0)
(outs
0)
(efr
'())
(efrr
'())
(state
state))
(cond ((not (or (= v root)
(= outs max-out)))
(vector-set! from-root v #T)
(let ((state
(-*- (+ v 1)
(+ outs 1)
(cons v efr)
(cons (vector-ref reach? v)
efrr)
state)))
(vector-set! from-root v #F)
(-*- (+ v 1)
outs
efr
efrr
state)))
((and (natural-for-all? root
(lambda (v)
(there-exists? efrr
(lambda (r)
(vector-ref r v)))))
(root-minimal?))
(vector-set! edges root efr)
(folder
(proc->vector size
(lambda (i)
(vector-ref edges i)))
state))
(else
state)))))
(else
(let ((from-vertex
(vector-ref edge? vertex)))
(let -**-
((sv
0)
(outs
0)
(state
state))
(if (= sv vertex)
(begin
(vector-set! out-degrees vertex outs)
(-*- (+ vertex 1)
state))
(let* ((state
; no sv->vertex, no vertex->sv
(-**- (+ sv 1)
outs
state))
(from-sv
(vector-ref edge? sv))
(sv-out
(vector-ref out-degrees sv))
(state
(if (= sv-out max-out)
state
(begin
(vector-set! edges
sv
(cons vertex
(vector-ref edges sv)))
(vector-set! from-sv vertex #T)
(vector-set! out-degrees sv (+ sv-out 1))
(let* ((state
; sv->vertex, no vertex->sv
(-**- (+ sv 1)
outs
state))
(state
(if (= outs max-out)
state
(begin
(vector-set! from-vertex sv #T)
(vector-set! edges
vertex
(cons sv
(vector-ref edges vertex)))
(let ((state
; sv->vertex, vertex->sv
(-**- (+ sv 1)
(+ outs 1)
state)))
(vector-set! edges
vertex
(cdr (vector-ref edges vertex)))
(vector-set! from-vertex sv #F)
state)))))
(vector-set! out-degrees sv sv-out)
(vector-set! from-sv vertex #F)
(vector-set! edges
sv
(cdr (vector-ref edges sv)))
state)))))
(if (= outs max-out)
state
(begin
(vector-set! edges
vertex
(cons sv
(vector-ref edges vertex)))
(vector-set! from-vertex sv #T)
(let ((state
; no sv->vertex, vertex->sv
(-**- (+ sv 1)
(+ outs 1)
state)))
(vector-set! from-vertex sv #F)
(vector-set! edges
vertex
(cdr (vector-ref edges vertex)))
state)))))))))))))
; Given a vector which maps vertex to out-going-edge list,
; return a vector which gives reachability.
(define make-reach?
(lambda (size vertex->out)
(let ((res
(proc->vector size
(lambda (v)
(let ((from-v
(make-vector size #F)))
(vector-set! from-v v #T)
(for-each
(lambda (x)
(vector-set! from-v x #T))
(vector-ref vertex->out v))
from-v)))))
(gnatural-for-each size
(lambda (m)
(let ((from-m
(vector-ref res m)))
(gnatural-for-each size
(lambda (f)
(let ((from-f
(vector-ref res f)))
(if (vector-ref from-f m); [wdc - was when]
(begin
(gnatural-for-each size
(lambda (t)
(if (vector-ref from-m t)
(begin ; [wdc - was when]
(vector-set! from-f t #T)))))))))))))
res)))
;;; ==== test input ====
; Produces all directed graphs with N verticies, distinguished root,
; and out-degree bounded by 2, upto isomorphism (there are 44).
;(define go
; (let ((N 7))
; (fold-over-rdg N
; 2
; cons
; '())))
(graphs-benchmark 6)

2
collects/tests/mzscheme/benchmarks/common/graphs.ss Normal file
View File

@ -0,0 +1,2 @@
(module graphs "wrap.ss")

759
collects/tests/mzscheme/benchmarks/common/nboyer.sch Normal file
View File

@ -0,0 +1,759 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: nboyer.sch
; Description: The Boyer benchmark
; Author: Bob Boyer
; Created: 5-Apr-85
; Modified: 10-Apr-85 14:52:20 (Bob Shaw)
; 22-Jul-87 (Will Clinger)
; 2-Jul-88 (Will Clinger -- distinguished #f and the empty list)
; 13-Feb-97 (Will Clinger -- fixed bugs in unifier and rules,
; rewrote to eliminate property lists, and added
; a scaling parameter suggested by Bob Boyer)
; 19-Mar-99 (Will Clinger -- cleaned up comments)
; 4-Apr-01 (Will Clinger -- changed four 1- symbols to sub1)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;; NBOYER -- Logic programming benchmark, originally written by Bob Boyer.
;;; Fairly CONS intensive.
; Note: The version of this benchmark that appears in Dick Gabriel's book
; contained several bugs that are corrected here. These bugs are discussed
; by Henry Baker, "The Boyer Benchmark Meets Linear Logic", ACM SIGPLAN Lisp
; Pointers 6(4), October-December 1993, pages 3-10. The fixed bugs are:
;
; The benchmark now returns a boolean result.
; FALSEP and TRUEP use TERM-MEMBER? rather than MEMV (which is called MEMBER
; in Common Lisp)
; ONE-WAY-UNIFY1 now treats numbers correctly
; ONE-WAY-UNIFY1-LST now treats empty lists correctly
; Rule 19 has been corrected (this rule was not touched by the original
; benchmark, but is used by this version)
; Rules 84 and 101 have been corrected (but these rules are never touched
; by the benchmark)
;
; According to Baker, these bug fixes make the benchmark 10-25% slower.
; Please do not compare the timings from this benchmark against those of
; the original benchmark.
;
; This version of the benchmark also prints the number of rewrites as a sanity
; check, because it is too easy for a buggy version to return the correct
; boolean result. The correct number of rewrites is
;
; n rewrites peak live storage (approximate, in bytes)
; 0 95024 520,000
; 1 591777 2,085,000
; 2 1813975 5,175,000
; 3 5375678
; 4 16445406
; 5 51507739
; Nboyer is a 2-phase benchmark.
; The first phase attaches lemmas to symbols. This phase is not timed,
; but it accounts for very little of the runtime anyway.
; The second phase creates the test problem, and tests to see
; whether it is implied by the lemmas.
(define (nboyer-benchmark . args)
(let ((n (if (null? args) 0 (car args))))
(setup-boyer)
(time (test-boyer n))))
(define (setup-boyer) #t) ; assigned below
(define (test-boyer) #t) ; assigned below
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;
; The first phase.
;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; In the original benchmark, it stored a list of lemmas on the
; property lists of symbols.
; In the new benchmark, it maintains an association list of
; symbols and symbol-records, and stores the list of lemmas
; within the symbol-records.
(let ()
(define (setup)
(add-lemma-lst
(quote ((equal (compile form)
(reverse (codegen (optimize form)
(nil))))
(equal (eqp x y)
(equal (fix x)
(fix y)))
(equal (greaterp x y)
(lessp y x))
(equal (lesseqp x y)
(not (lessp y x)))
(equal (greatereqp x y)
(not (lessp x y)))
(equal (boolean x)
(or (equal x (t))
(equal x (f))))
(equal (iff x y)
(and (implies x y)
(implies y x)))
(equal (even1 x)
(if (zerop x)
(t)
(odd (sub1 x))))
(equal (countps- l pred)
(countps-loop l pred (zero)))
(equal (fact- i)
(fact-loop i 1))
(equal (reverse- x)
(reverse-loop x (nil)))
(equal (divides x y)
(zerop (remainder y x)))
(equal (assume-true var alist)
(cons (cons var (t))
alist))
(equal (assume-false var alist)
(cons (cons var (f))
alist))
(equal (tautology-checker x)
(tautologyp (normalize x)
(nil)))
(equal (falsify x)
(falsify1 (normalize x)
(nil)))
(equal (prime x)
(and (not (zerop x))
(not (equal x (add1 (zero))))
(prime1 x (sub1 x))))
(equal (and p q)
(if p (if q (t)
(f))
(f)))
(equal (or p q)
(if p (t)
(if q (t)
(f))))
(equal (not p)
(if p (f)
(t)))
(equal (implies p q)
(if p (if q (t)
(f))
(t)))
(equal (fix x)
(if (numberp x)
x
(zero)))
(equal (if (if a b c)
d e)
(if a (if b d e)
(if c d e)))
(equal (zerop x)
(or (equal x (zero))
(not (numberp x))))
(equal (plus (plus x y)
z)
(plus x (plus y z)))
(equal (equal (plus a b)
(zero))
(and (zerop a)
(zerop b)))
(equal (difference x x)
(zero))
(equal (equal (plus a b)
(plus a c))
(equal (fix b)
(fix c)))
(equal (equal (zero)
(difference x y))
(not (lessp y x)))
(equal (equal x (difference x y))
(and (numberp x)
(or (equal x (zero))
(zerop y))))
(equal (meaning (plus-tree (append x y))
a)
(plus (meaning (plus-tree x)
a)
(meaning (plus-tree y)
a)))
(equal (meaning (plus-tree (plus-fringe x))
a)
(fix (meaning x a)))
(equal (append (append x y)
z)
(append x (append y z)))
(equal (reverse (append a b))
(append (reverse b)
(reverse a)))
(equal (times x (plus y z))
(plus (times x y)
(times x z)))
(equal (times (times x y)
z)
(times x (times y z)))
(equal (equal (times x y)
(zero))
(or (zerop x)
(zerop y)))
(equal (exec (append x y)
pds envrn)
(exec y (exec x pds envrn)
envrn))
(equal (mc-flatten x y)
(append (flatten x)
y))
(equal (member x (append a b))
(or (member x a)
(member x b)))
(equal (member x (reverse y))
(member x y))
(equal (length (reverse x))
(length x))
(equal (member a (intersect b c))
(and (member a b)
(member a c)))
(equal (nth (zero)
i)
(zero))
(equal (exp i (plus j k))
(times (exp i j)
(exp i k)))
(equal (exp i (times j k))
(exp (exp i j)
k))
(equal (reverse-loop x y)
(append (reverse x)
y))
(equal (reverse-loop x (nil))
(reverse x))
(equal (count-list z (sort-lp x y))
(plus (count-list z x)
(count-list z y)))
(equal (equal (append a b)
(append a c))
(equal b c))
(equal (plus (remainder x y)
(times y (quotient x y)))
(fix x))
(equal (power-eval (big-plus1 l i base)
base)
(plus (power-eval l base)
i))
(equal (power-eval (big-plus x y i base)
base)
(plus i (plus (power-eval x base)
(power-eval y base))))
(equal (remainder y 1)
(zero))
(equal (lessp (remainder x y)
y)
(not (zerop y)))
(equal (remainder x x)
(zero))
(equal (lessp (quotient i j)
i)
(and (not (zerop i))
(or (zerop j)
(not (equal j 1)))))
(equal (lessp (remainder x y)
x)
(and (not (zerop y))
(not (zerop x))
(not (lessp x y))))
(equal (power-eval (power-rep i base)
base)
(fix i))
(equal (power-eval (big-plus (power-rep i base)
(power-rep j base)
(zero)
base)
base)
(plus i j))
(equal (gcd x y)
(gcd y x))
(equal (nth (append a b)
i)
(append (nth a i)
(nth b (difference i (length a)))))
(equal (difference (plus x y)
x)
(fix y))
(equal (difference (plus y x)
x)
(fix y))
(equal (difference (plus x y)
(plus x z))
(difference y z))
(equal (times x (difference c w))
(difference (times c x)
(times w x)))
(equal (remainder (times x z)
z)
(zero))
(equal (difference (plus b (plus a c))
a)
(plus b c))
(equal (difference (add1 (plus y z))
z)
(add1 y))
(equal (lessp (plus x y)
(plus x z))
(lessp y z))
(equal (lessp (times x z)
(times y z))
(and (not (zerop z))
(lessp x y)))
(equal (lessp y (plus x y))
(not (zerop x)))
(equal (gcd (times x z)
(times y z))
(times z (gcd x y)))
(equal (value (normalize x)
a)
(value x a))
(equal (equal (flatten x)
(cons y (nil)))
(and (nlistp x)
(equal x y)))
(equal (listp (gopher x))
(listp x))
(equal (samefringe x y)
(equal (flatten x)
(flatten y)))
(equal (equal (greatest-factor x y)
(zero))
(and (or (zerop y)
(equal y 1))
(equal x (zero))))
(equal (equal (greatest-factor x y)
1)
(equal x 1))
(equal (numberp (greatest-factor x y))
(not (and (or (zerop y)
(equal y 1))
(not (numberp x)))))
(equal (times-list (append x y))
(times (times-list x)
(times-list y)))
(equal (prime-list (append x y))
(and (prime-list x)
(prime-list y)))
(equal (equal z (times w z))
(and (numberp z)
(or (equal z (zero))
(equal w 1))))
(equal (greatereqp x y)
(not (lessp x y)))
(equal (equal x (times x y))
(or (equal x (zero))
(and (numberp x)
(equal y 1))))
(equal (remainder (times y x)
y)
(zero))
(equal (equal (times a b)
1)
(and (not (equal a (zero)))
(not (equal b (zero)))
(numberp a)
(numberp b)
(equal (sub1 a)
(zero))
(equal (sub1 b)
(zero))))
(equal (lessp (length (delete x l))
(length l))
(member x l))
(equal (sort2 (delete x l))
(delete x (sort2 l)))
(equal (dsort x)
(sort2 x))
(equal (length (cons x1
(cons x2
(cons x3 (cons x4
(cons x5
(cons x6 x7)))))))
(plus 6 (length x7)))
(equal (difference (add1 (add1 x))
2)
(fix x))
(equal (quotient (plus x (plus x y))
2)
(plus x (quotient y 2)))
(equal (sigma (zero)
i)
(quotient (times i (add1 i))
2))
(equal (plus x (add1 y))
(if (numberp y)
(add1 (plus x y))
(add1 x)))
(equal (equal (difference x y)
(difference z y))
(if (lessp x y)
(not (lessp y z))
(if (lessp z y)
(not (lessp y x))
(equal (fix x)
(fix z)))))
(equal (meaning (plus-tree (delete x y))
a)
(if (member x y)
(difference (meaning (plus-tree y)
a)
(meaning x a))
(meaning (plus-tree y)
a)))
(equal (times x (add1 y))
(if (numberp y)
(plus x (times x y))
(fix x)))
(equal (nth (nil)
i)
(if (zerop i)
(nil)
(zero)))
(equal (last (append a b))
(if (listp b)
(last b)
(if (listp a)
(cons (car (last a))
b)
b)))
(equal (equal (lessp x y)
z)
(if (lessp x y)
(equal (t) z)
(equal (f) z)))
(equal (assignment x (append a b))
(if (assignedp x a)
(assignment x a)
(assignment x b)))
(equal (car (gopher x))
(if (listp x)
(car (flatten x))
(zero)))
(equal (flatten (cdr (gopher x)))
(if (listp x)
(cdr (flatten x))
(cons (zero)
(nil))))
(equal (quotient (times y x)
y)
(if (zerop y)
(zero)
(fix x)))
(equal (get j (set i val mem))
(if (eqp j i)
val
(get j mem)))))))
(define (add-lemma-lst lst)
(cond ((null? lst)
#t)
(else (add-lemma (car lst))
(add-lemma-lst (cdr lst)))))
(define (add-lemma term)
(cond ((and (pair? term)
(eq? (car term)
(quote equal))
(pair? (cadr term)))
(put (car (cadr term))
(quote lemmas)
(cons
(translate-term term)
(get (car (cadr term)) (quote lemmas)))))
(else (error "ADD-LEMMA did not like term: " term))))
; Translates a term by replacing its constructor symbols by symbol-records.
(define (translate-term term)
(cond ((not (pair? term))
term)
(else (cons (symbol->symbol-record (car term))
(translate-args (cdr term))))))
(define (translate-args lst)
(cond ((null? lst)
'())
(else (cons (translate-term (car lst))
(translate-args (cdr lst))))))
; For debugging only, so the use of MAP does not change
; the first-order character of the benchmark.
(define (untranslate-term term)
(cond ((not (pair? term))
term)
(else (cons (get-name (car term))
(map untranslate-term (cdr term))))))
; A symbol-record is represented as a vector with two fields:
; the symbol (for debugging) and
; the list of lemmas associated with the symbol.
(define (put sym property value)
(put-lemmas! (symbol->symbol-record sym) value))
(define (get sym property)
(get-lemmas (symbol->symbol-record sym)))
(define (symbol->symbol-record sym)
(let ((x (assq sym *symbol-records-alist*)))
(if x
(cdr x)
(let ((r (make-symbol-record sym)))
(set! *symbol-records-alist*
(cons (cons sym r)
*symbol-records-alist*))
r))))
; Association list of symbols and symbol-records.
(define *symbol-records-alist* '())
; A symbol-record is represented as a vector with two fields:
; the symbol (for debugging) and
; the list of lemmas associated with the symbol.
(define (make-symbol-record sym)
(vector sym '()))
(define (put-lemmas! symbol-record lemmas)
(vector-set! symbol-record 1 lemmas))
(define (get-lemmas symbol-record)
(vector-ref symbol-record 1))
(define (get-name symbol-record)
(vector-ref symbol-record 0))
(define (symbol-record-equal? r1 r2)
(eq? r1 r2))
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;
; The second phase.
;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
(define (test n)
(let ((term
(apply-subst
(translate-alist
(quote ((x f (plus (plus a b)
(plus c (zero))))
(y f (times (times a b)
(plus c d)))
(z f (reverse (append (append a b)
(nil))))
(u equal (plus a b)
(difference x y))
(w lessp (remainder a b)
(member a (length b))))))
(translate-term
(do ((term
(quote (implies (and (implies x y)
(and (implies y z)
(and (implies z u)
(implies u w))))
(implies x w)))
(list 'or term '(f)))
(n n (- n 1)))
((zero? n) term))))))
(tautp term)))
(define (translate-alist alist)
(cond ((null? alist)
'())
(else (cons (cons (caar alist)
(translate-term (cdar alist)))
(translate-alist (cdr alist))))))
(define (apply-subst alist term)
(cond ((not (pair? term))
(let ((temp-temp (assq term alist)))
(if temp-temp
(cdr temp-temp)
term)))
(else (cons (car term)
(apply-subst-lst alist (cdr term))))))
(define (apply-subst-lst alist lst)
(cond ((null? lst)
'())
(else (cons (apply-subst alist (car lst))
(apply-subst-lst alist (cdr lst))))))
(define (tautp x)
(tautologyp (rewrite x)
'() '()))
(define (tautologyp x true-lst false-lst)
(cond ((truep x true-lst)
#t)
((falsep x false-lst)
#f)
((not (pair? x))
#f)
((eq? (car x) if-constructor)
(cond ((truep (cadr x)
true-lst)
(tautologyp (caddr x)
true-lst false-lst))
((falsep (cadr x)
false-lst)
(tautologyp (cadddr x)
true-lst false-lst))
(else (and (tautologyp (caddr x)
(cons (cadr x)
true-lst)
false-lst)
(tautologyp (cadddr x)
true-lst
(cons (cadr x)
false-lst))))))
(else #f)))
(define if-constructor '*) ; becomes (symbol->symbol-record 'if)
(define rewrite-count 0) ; sanity check
(define (rewrite term)
(set! rewrite-count (+ rewrite-count 1))
(cond ((not (pair? term))
term)
(else (rewrite-with-lemmas (cons (car term)
(rewrite-args (cdr term)))
(get-lemmas (car term))))))
(define (rewrite-args lst)
(cond ((null? lst)
'())
(else (cons (rewrite (car lst))
(rewrite-args (cdr lst))))))
(define (rewrite-with-lemmas term lst)
(cond ((null? lst)
term)
((one-way-unify term (cadr (car lst)))
(rewrite (apply-subst unify-subst (caddr (car lst)))))
(else (rewrite-with-lemmas term (cdr lst)))))
(define unify-subst '*)
(define (one-way-unify term1 term2)
(begin (set! unify-subst '())
(one-way-unify1 term1 term2)))
(define (one-way-unify1 term1 term2)
(cond ((not (pair? term2))
(let ((temp-temp (assq term2 unify-subst)))
(cond (temp-temp
(term-equal? term1 (cdr temp-temp)))
((number? term2) ; This bug fix makes
(equal? term1 term2)) ; nboyer 10-25% slower!
(else
(set! unify-subst (cons (cons term2 term1)
unify-subst))
#t))))
((not (pair? term1))
#f)
((eq? (car term1)
(car term2))
(one-way-unify1-lst (cdr term1)
(cdr term2)))
(else #f)))
(define (one-way-unify1-lst lst1 lst2)
(cond ((null? lst1)
(null? lst2))
((null? lst2)
#f)
((one-way-unify1 (car lst1)
(car lst2))
(one-way-unify1-lst (cdr lst1)
(cdr lst2)))
(else #f)))
(define (falsep x lst)
(or (term-equal? x false-term)
(term-member? x lst)))
(define (truep x lst)
(or (term-equal? x true-term)
(term-member? x lst)))
(define false-term '*) ; becomes (translate-term '(f))
(define true-term '*) ; becomes (translate-term '(t))
; The next two procedures were in the original benchmark
; but were never used.
(define (trans-of-implies n)
(translate-term
(list (quote implies)
(trans-of-implies1 n)
(list (quote implies)
0 n))))
(define (trans-of-implies1 n)
(cond ((equal? n 1)
(list (quote implies)
0 1))
(else (list (quote and)
(list (quote implies)
(- n 1)
n)
(trans-of-implies1 (- n 1))))))
; Translated terms can be circular structures, which can't be
; compared using Scheme's equal? and member procedures, so we
; use these instead.
(define (term-equal? x y)
(cond ((pair? x)
(and (pair? y)
(symbol-record-equal? (car x) (car y))
(term-args-equal? (cdr x) (cdr y))))
(else (equal? x y))))
(define (term-args-equal? lst1 lst2)
(cond ((null? lst1)
(null? lst2))
((null? lst2)
#f)
((term-equal? (car lst1) (car lst2))
(term-args-equal? (cdr lst1) (cdr lst2)))
(else #f)))
(define (term-member? x lst)
(cond ((null? lst)
#f)
((term-equal? x (car lst))
#t)
(else (term-member? x (cdr lst)))))
(set! setup-boyer
(lambda ()
(set! *symbol-records-alist* '())
(set! if-constructor (symbol->symbol-record 'if))
(set! false-term (translate-term '(f)))
(set! true-term (translate-term '(t)))
(setup)))
(set! test-boyer
(lambda (n)
(set! rewrite-count 0)
(let ((answer (test n)))
(write rewrite-count)
(display " rewrites")
(newline)
(if answer
rewrite-count
#f)))))
(nboyer-benchmark 4)

2
collects/tests/mzscheme/benchmarks/common/nboyer.ss Normal file
View File

@ -0,0 +1,2 @@
(module nboyer "wrap.ss")

48
collects/tests/mzscheme/benchmarks/common/nfa.sch Normal file
View File

@ -0,0 +1,48 @@
; The recursive-nfa benchmark. (Figure 45, page 143.)
(define (recursive-nfa input)
(define (state0 input)
(or (state1 input) (state3 input) #f))
(define (state1 input)
(and (not (null? input))
(or (and (char=? (car input) #\a)
(state1 (cdr input)))
(and (char=? (car input) #\c)
(state1 input))
(state2 input))))
(define (state2 input)
(and (not (null? input))
(char=? (car input) #\b)
(not (null? (cdr input)))
(char=? (cadr input) #\c)
(not (null? (cddr input)))
(char=? (caddr input) #\d)
'state2))
(define (state3 input)
(and (not (null? input))
(or (and (char=? (car input) #\a)
(state3 (cdr input)))
(state4 input))))
(define (state4 input)
(and (not (null? input))
(char=? (car input) #\b)
(not (null? (cdr input)))
(char=? (cadr input) #\c)
'state4))
(or (state0 (string->list input))
'fail))
(time (let ([input (string-append (make-string 133 #\a) "bc")])
(let loop ([n 10000])
(unless (zero? n)
(recursive-nfa input)
(loop (sub1 n))))))

2
collects/tests/mzscheme/benchmarks/common/nfa.ss Normal file
View File

@ -0,0 +1,2 @@
(module nfa "wrap.ss")

3759
collects/tests/mzscheme/benchmarks/common/nucleic2.sch Normal file
View File

File diff suppressed because it is too large Load Diff

2
collects/tests/mzscheme/benchmarks/common/nucleic2.ss Normal file
View File

@ -0,0 +1,2 @@
(module nucleic2 "wrap.ss")

169
collects/tests/mzscheme/benchmarks/common/puzzle.sch Normal file
View File

@ -0,0 +1,169 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: puzzle.sch
; Description: PUZZLE benchmark
; Author: Richard Gabriel, after Forrest Baskett
; Created: 12-Apr-85
; Modified: 12-Apr-85 14:20:23 (Bob Shaw)
; 11-Aug-87 (Will Clinger)
; 22-Jan-88 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
(define (iota n)
(do ((n n (- n 1))
(list '() (cons (- n 1) list)))
((zero? n) list)))
;;; PUZZLE -- Forest Baskett's Puzzle benchmark, originally written in Pascal.
(define size 1048575)
(define classmax 3)
(define typemax 12)
(define *iii* 0)
(define *kount* 0)
(define *d* 8)
(define *piececount* (make-vector (+ classmax 1) 0))
(define *class* (make-vector (+ typemax 1) 0))
(define *piecemax* (make-vector (+ typemax 1) 0))
(define *puzzle* (make-vector (+ size 1)))
(define *p* (make-vector (+ typemax 1)))
(for-each (lambda (i) (vector-set! *p* i (make-vector (+ size 1))))
(iota (+ typemax 1)))
(define (fit i j)
(let ((end (vector-ref *piecemax* i)))
(do ((k 0 (+ k 1)))
((or (> k end)
(and (vector-ref (vector-ref *p* i) k)
(vector-ref *puzzle* (+ j k))))
(if (> k end) #t #f)))))
(define (place i j)
(let ((end (vector-ref *piecemax* i)))
(do ((k 0 (+ k 1)))
((> k end))
(cond ((vector-ref (vector-ref *p* i) k)
(vector-set! *puzzle* (+ j k) #t)
#t)))
(vector-set! *piececount*
(vector-ref *class* i)
(- (vector-ref *piececount* (vector-ref *class* i)) 1))
(do ((k j (+ k 1)))
((or (> k size) (not (vector-ref *puzzle* k)))
; (newline)
; (display "*Puzzle* filled")
(if (> k size) 0 k)))))
(define (puzzle-remove i j)
(let ((end (vector-ref *piecemax* i)))
(do ((k 0 (+ k 1)))
((> k end))
(cond ((vector-ref (vector-ref *p* i) k)
(vector-set! *puzzle* (+ j k) #f)
#f)))
(vector-set! *piececount*
(vector-ref *class* i)
(+ (vector-ref *piececount* (vector-ref *class* i)) 1))))
(define (trial j)
(let ((k 0))
(call-with-current-continuation
(lambda (return)
(do ((i 0 (+ i 1)))
((> i typemax) (set! *kount* (+ *kount* 1)) '())
(cond
((not
(zero?
(vector-ref *piececount* (vector-ref *class* i))))
(cond
((fit i j)
(set! k (place i j))
(cond
((or (trial k) (zero? k))
;(trial-output (+ i 1) (+ k 1))
(set! *kount* (+ *kount* 1))
(return #t))
(else (puzzle-remove i j))))))))))))
(define (trial-output x y)
(newline)
(display (string-append "Piece "
(number->string x '(int))
" at "
(number->string y '(int))
".")))
(define (definePiece iclass ii jj kk)
(let ((index 0))
(do ((i 0 (+ i 1)))
((> i ii))
(do ((j 0 (+ j 1)))
((> j jj))
(do ((k 0 (+ k 1)))
((> k kk))
(set! index (+ i (* *d* (+ j (* *d* k)))))
(vector-set! (vector-ref *p* *iii*) index #t))))
(vector-set! *class* *iii* iclass)
(vector-set! *piecemax* *iii* index)
(cond ((not (= *iii* typemax))
(set! *iii* (+ *iii* 1))))))
(define (start)
(do ((m 0 (+ m 1)))
((> m size))
(vector-set! *puzzle* m #t))
(do ((i 1 (+ i 1)))
((> i 5))
(do ((j 1 (+ j 1)))
((> j 5))
(do ((k 1 (+ k 1)))
((> k 5))
(vector-set! *puzzle* (+ i (* *d* (+ j (* *d* k)))) #f))))
(do ((i 0 (+ i 1)))
((> i typemax))
(do ((m 0 (+ m 1)))
((> m size))
(vector-set! (vector-ref *p* i) m #f)))
(set! *iii* 0)
(definePiece 0 3 1 0)
(definePiece 0 1 0 3)
(definePiece 0 0 3 1)
(definePiece 0 1 3 0)
(definePiece 0 3 0 1)
(definePiece 0 0 1 3)
(definePiece 1 2 0 0)
(definePiece 1 0 2 0)
(definePiece 1 0 0 2)
(definePiece 2 1 1 0)
(definePiece 2 1 0 1)
(definePiece 2 0 1 1)
(definePiece 3 1 1 1)
(vector-set! *piececount* 0 13)
(vector-set! *piececount* 1 3)
(vector-set! *piececount* 2 1)
(vector-set! *piececount* 3 1)
(let ((m (+ (* *d* (+ *d* 1)) 1))
(n 0))
(cond ((fit 0 m) (set! n (place 0 m)))
(else (begin (newline) (display "Error."))))
(cond ((trial n)
(begin (newline)
(display "Success in ")
(write *kount*)
(display " trials.")
(newline)))
(else (begin (newline) (display "Failure."))))))
;;; call: (start)
(time (start))

2
collects/tests/mzscheme/benchmarks/common/puzzle.ss Normal file
View File

@ -0,0 +1,2 @@
(module puzzle "wrap.ss")

774
collects/tests/mzscheme/benchmarks/common/sboyer.sch Normal file
View File

@ -0,0 +1,774 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: sboyer.sch
; Description: The Boyer benchmark
; Author: Bob Boyer
; Created: 5-Apr-85
; Modified: 10-Apr-85 14:52:20 (Bob Shaw)
; 22-Jul-87 (Will Clinger)
; 2-Jul-88 (Will Clinger -- distinguished #f and the empty list)
; 13-Feb-97 (Will Clinger -- fixed bugs in unifier and rules,
; rewrote to eliminate property lists, and added
; a scaling parameter suggested by Bob Boyer)
; 19-Mar-99 (Will Clinger -- cleaned up comments)
; 4-Apr-01 (Will Clinger -- changed four 1- symbols to sub1)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;; SBOYER -- Logic programming benchmark, originally written by Bob Boyer.
;;; Much less CONS-intensive than NBOYER because it uses Henry Baker's
;;; "sharing cons".
; Note: The version of this benchmark that appears in Dick Gabriel's book
; contained several bugs that are corrected here. These bugs are discussed
; by Henry Baker, "The Boyer Benchmark Meets Linear Logic", ACM SIGPLAN Lisp
; Pointers 6(4), October-December 1993, pages 3-10. The fixed bugs are:
;
; The benchmark now returns a boolean result.
; FALSEP and TRUEP use TERM-MEMBER? rather than MEMV (which is called MEMBER
; in Common Lisp)
; ONE-WAY-UNIFY1 now treats numbers correctly
; ONE-WAY-UNIFY1-LST now treats empty lists correctly
; Rule 19 has been corrected (this rule was not touched by the original
; benchmark, but is used by this version)
; Rules 84 and 101 have been corrected (but these rules are never touched
; by the benchmark)
;
; According to Baker, these bug fixes make the benchmark 10-25% slower.
; Please do not compare the timings from this benchmark against those of
; the original benchmark.
;
; This version of the benchmark also prints the number of rewrites as a sanity
; check, because it is too easy for a buggy version to return the correct
; boolean result. The correct number of rewrites is
;
; n rewrites peak live storage (approximate, in bytes)
; 0 95024
; 1 591777
; 2 1813975
; 3 5375678
; 4 16445406
; 5 51507739
; Sboyer is a 2-phase benchmark.
; The first phase attaches lemmas to symbols. This phase is not timed,
; but it accounts for very little of the runtime anyway.
; The second phase creates the test problem, and tests to see
; whether it is implied by the lemmas.
(define (sboyer-benchmark . args)
(let ((n (if (null? args) 0 (car args))))
(setup-boyer)
(time (test-boyer n))))
(define (setup-boyer) #t) ; assigned below
(define (test-boyer) #t) ; assigned below
(define (id x) x)
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;
; The first phase.
;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; In the original benchmark, it stored a list of lemmas on the
; property lists of symbols.
; In the new benchmark, it maintains an association list of
; symbols and symbol-records, and stores the list of lemmas
; within the symbol-records.
(let ()
(define (setup)
(add-lemma-lst
(quote ((equal (compile form)
(reverse (codegen (optimize form)
(nil))))
(equal (eqp x y)
(equal (fix x)
(fix y)))
(equal (greaterp x y)
(lessp y x))
(equal (lesseqp x y)
(not (lessp y x)))
(equal (greatereqp x y)
(not (lessp x y)))
(equal (boolean x)
(or (equal x (t))
(equal x (f))))
(equal (iff x y)
(and (implies x y)
(implies y x)))
(equal (even1 x)
(if (zerop x)
(t)
(odd (sub1 x))))
(equal (countps- l pred)
(countps-loop l pred (zero)))
(equal (fact- i)
(fact-loop i 1))
(equal (reverse- x)
(reverse-loop x (nil)))
(equal (divides x y)
(zerop (remainder y x)))
(equal (assume-true var alist)
(cons (cons var (t))
alist))
(equal (assume-false var alist)
(cons (cons var (f))
alist))
(equal (tautology-checker x)
(tautologyp (normalize x)
(nil)))
(equal (falsify x)
(falsify1 (normalize x)
(nil)))
(equal (prime x)
(and (not (zerop x))
(not (equal x (add1 (zero))))
(prime1 x (sub1 x))))
(equal (and p q)
(if p (if q (t)
(f))
(f)))
(equal (or p q)
(if p (t)
(if q (t)
(f))))
(equal (not p)
(if p (f)
(t)))
(equal (implies p q)
(if p (if q (t)
(f))
(t)))
(equal (fix x)
(if (numberp x)
x
(zero)))
(equal (if (if a b c)
d e)
(if a (if b d e)
(if c d e)))
(equal (zerop x)
(or (equal x (zero))
(not (numberp x))))
(equal (plus (plus x y)
z)
(plus x (plus y z)))
(equal (equal (plus a b)
(zero))
(and (zerop a)
(zerop b)))
(equal (difference x x)
(zero))
(equal (equal (plus a b)
(plus a c))
(equal (fix b)
(fix c)))
(equal (equal (zero)
(difference x y))
(not (lessp y x)))
(equal (equal x (difference x y))
(and (numberp x)
(or (equal x (zero))
(zerop y))))
(equal (meaning (plus-tree (append x y))
a)
(plus (meaning (plus-tree x)
a)
(meaning (plus-tree y)
a)))
(equal (meaning (plus-tree (plus-fringe x))
a)
(fix (meaning x a)))
(equal (append (append x y)
z)
(append x (append y z)))
(equal (reverse (append a b))
(append (reverse b)
(reverse a)))
(equal (times x (plus y z))
(plus (times x y)
(times x z)))
(equal (times (times x y)
z)
(times x (times y z)))
(equal (equal (times x y)
(zero))
(or (zerop x)
(zerop y)))
(equal (exec (append x y)
pds envrn)
(exec y (exec x pds envrn)
envrn))
(equal (mc-flatten x y)
(append (flatten x)
y))
(equal (member x (append a b))
(or (member x a)
(member x b)))
(equal (member x (reverse y))
(member x y))
(equal (length (reverse x))
(length x))
(equal (member a (intersect b c))
(and (member a b)
(member a c)))
(equal (nth (zero)
i)
(zero))
(equal (exp i (plus j k))
(times (exp i j)
(exp i k)))
(equal (exp i (times j k))
(exp (exp i j)
k))
(equal (reverse-loop x y)
(append (reverse x)
y))
(equal (reverse-loop x (nil))
(reverse x))
(equal (count-list z (sort-lp x y))
(plus (count-list z x)
(count-list z y)))
(equal (equal (append a b)
(append a c))
(equal b c))
(equal (plus (remainder x y)
(times y (quotient x y)))
(fix x))
(equal (power-eval (big-plus1 l i base)
base)
(plus (power-eval l base)
i))
(equal (power-eval (big-plus x y i base)
base)
(plus i (plus (power-eval x base)
(power-eval y base))))
(equal (remainder y 1)
(zero))
(equal (lessp (remainder x y)
y)
(not (zerop y)))
(equal (remainder x x)
(zero))
(equal (lessp (quotient i j)
i)
(and (not (zerop i))
(or (zerop j)
(not (equal j 1)))))
(equal (lessp (remainder x y)
x)
(and (not (zerop y))
(not (zerop x))
(not (lessp x y))))
(equal (power-eval (power-rep i base)
base)
(fix i))
(equal (power-eval (big-plus (power-rep i base)
(power-rep j base)
(zero)
base)
base)
(plus i j))
(equal (gcd x y)
(gcd y x))
(equal (nth (append a b)
i)
(append (nth a i)
(nth b (difference i (length a)))))
(equal (difference (plus x y)
x)
(fix y))
(equal (difference (plus y x)
x)
(fix y))
(equal (difference (plus x y)
(plus x z))
(difference y z))
(equal (times x (difference c w))
(difference (times c x)
(times w x)))
(equal (remainder (times x z)
z)
(zero))
(equal (difference (plus b (plus a c))
a)
(plus b c))
(equal (difference (add1 (plus y z))
z)
(add1 y))
(equal (lessp (plus x y)
(plus x z))
(lessp y z))
(equal (lessp (times x z)
(times y z))
(and (not (zerop z))
(lessp x y)))
(equal (lessp y (plus x y))
(not (zerop x)))
(equal (gcd (times x z)
(times y z))
(times z (gcd x y)))
(equal (value (normalize x)
a)
(value x a))
(equal (equal (flatten x)
(cons y (nil)))
(and (nlistp x)
(equal x y)))
(equal (listp (gopher x))
(listp x))
(equal (samefringe x y)
(equal (flatten x)
(flatten y)))
(equal (equal (greatest-factor x y)
(zero))
(and (or (zerop y)
(equal y 1))
(equal x (zero))))
(equal (equal (greatest-factor x y)
1)
(equal x 1))
(equal (numberp (greatest-factor x y))
(not (and (or (zerop y)
(equal y 1))
(not (numberp x)))))
(equal (times-list (append x y))
(times (times-list x)
(times-list y)))
(equal (prime-list (append x y))
(and (prime-list x)
(prime-list y)))
(equal (equal z (times w z))
(and (numberp z)
(or (equal z (zero))
(equal w 1))))
(equal (greatereqp x y)
(not (lessp x y)))
(equal (equal x (times x y))
(or (equal x (zero))
(and (numberp x)
(equal y 1))))
(equal (remainder (times y x)
y)
(zero))
(equal (equal (times a b)
1)
(and (not (equal a (zero)))
(not (equal b (zero)))
(numberp a)
(numberp b)
(equal (sub1 a)
(zero))
(equal (sub1 b)
(zero))))
(equal (lessp (length (delete x l))
(length l))
(member x l))
(equal (sort2 (delete x l))
(delete x (sort2 l)))
(equal (dsort x)
(sort2 x))
(equal (length (cons x1
(cons x2
(cons x3 (cons x4
(cons x5
(cons x6 x7)))))))
(plus 6 (length x7)))
(equal (difference (add1 (add1 x))
2)
(fix x))
(equal (quotient (plus x (plus x y))
2)
(plus x (quotient y 2)))
(equal (sigma (zero)
i)
(quotient (times i (add1 i))
2))
(equal (plus x (add1 y))
(if (numberp y)
(add1 (plus x y))
(add1 x)))
(equal (equal (difference x y)
(difference z y))
(if (lessp x y)
(not (lessp y z))
(if (lessp z y)
(not (lessp y x))
(equal (fix x)
(fix z)))))
(equal (meaning (plus-tree (delete x y))
a)
(if (member x y)
(difference (meaning (plus-tree y)
a)
(meaning x a))
(meaning (plus-tree y)
a)))
(equal (times x (add1 y))
(if (numberp y)
(plus x (times x y))
(fix x)))
(equal (nth (nil)
i)
(if (zerop i)
(nil)
(zero)))
(equal (last (append a b))
(if (listp b)
(last b)
(if (listp a)
(cons (car (last a))
b)
b)))
(equal (equal (lessp x y)
z)
(if (lessp x y)
(equal (t) z)
(equal (f) z)))
(equal (assignment x (append a b))
(if (assignedp x a)
(assignment x a)
(assignment x b)))
(equal (car (gopher x))
(if (listp x)
(car (flatten x))
(zero)))
(equal (flatten (cdr (gopher x)))
(if (listp x)
(cdr (flatten x))
(cons (zero)
(nil))))
(equal (quotient (times y x)
y)
(if (zerop y)
(zero)
(fix x)))
(equal (get j (set i val mem))
(if (eqp j i)
val
(get j mem)))))))
(define (add-lemma-lst lst)
(cond ((null? lst)
#t)
(else (add-lemma (car lst))
(add-lemma-lst (cdr lst)))))
(define (add-lemma term)
(cond ((and (pair? term)
(eq? (car term)
(quote equal))
(pair? (cadr term)))
(put (car (cadr term))
(quote lemmas)
(cons
(translate-term term)
(get (car (cadr term)) (quote lemmas)))))
(else (error "ADD-LEMMA did not like term: " term))))
; Translates a term by replacing its constructor symbols by symbol-records.
(define (translate-term term)
(cond ((not (pair? term))
term)
(else (cons (symbol->symbol-record (car term))
(translate-args (cdr term))))))
(define (translate-args lst)
(cond ((null? lst)
'())
(else (cons (translate-term (car lst))
(translate-args (cdr lst))))))
; For debugging only, so the use of MAP does not change
; the first-order character of the benchmark.
(define (untranslate-term term)
(cond ((not (pair? term))
term)
(else (cons (get-name (car term))
(map untranslate-term (cdr term))))))
; A symbol-record is represented as a vector with two fields:
; the symbol (for debugging) and
; the list of lemmas associated with the symbol.
(define (put sym property value)
(put-lemmas! (symbol->symbol-record sym) value))
(define (get sym property)
(get-lemmas (symbol->symbol-record sym)))
(define (symbol->symbol-record sym)
(let ((x (assq sym *symbol-records-alist*)))
(if x
(cdr x)
(let ((r (make-symbol-record sym)))
(set! *symbol-records-alist*
(cons (cons sym r)
*symbol-records-alist*))
r))))
; Association list of symbols and symbol-records.
(define *symbol-records-alist* '())
; A symbol-record is represented as a vector with two fields:
; the symbol (for debugging) and
; the list of lemmas associated with the symbol.
(define (make-symbol-record sym)
(vector sym '()))
(define (put-lemmas! symbol-record lemmas)
(vector-set! symbol-record 1 lemmas))
(define (get-lemmas symbol-record)
(vector-ref symbol-record 1))
(define (get-name symbol-record)
(vector-ref symbol-record 0))
(define (symbol-record-equal? r1 r2)
(eq? r1 r2))
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;
; The second phase.
;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
(define (test n)
(let ((term
(apply-subst
(translate-alist
(quote ((x f (plus (plus a b)
(plus c (zero))))
(y f (times (times a b)
(plus c d)))
(z f (reverse (append (append a b)
(nil))))
(u equal (plus a b)
(difference x y))
(w lessp (remainder a b)
(member a (length b))))))
(translate-term
(do ((term
(quote (implies (and (implies x y)
(and (implies y z)
(and (implies z u)
(implies u w))))
(implies x w)))
(list 'or term '(f)))
(n n (- n 1)))
((zero? n) term))))))
(tautp term)))
(define (translate-alist alist)
(cond ((null? alist)
'())
(else (cons (cons (caar alist)
(translate-term (cdar alist)))
(translate-alist (cdr alist))))))
(define (apply-subst alist term)
(cond ((not (pair? term))
(let ((temp-temp (assq term alist)))
(if temp-temp
(cdr temp-temp)
term)))
(else (cons (car term)
(apply-subst-lst alist (cdr term))))))
(define (apply-subst-lst alist lst)
(cond ((null? lst)
'())
(else (cons (apply-subst alist (car lst))
(apply-subst-lst alist (cdr lst))))))
(define (tautp x)
(tautologyp (rewrite x)
'() '()))
(define (tautologyp x true-lst false-lst)
(cond ((truep x true-lst)
#t)
((falsep x false-lst)
#f)
((not (pair? x))
#f)
((eq? (car x) if-constructor)
(cond ((truep (cadr x)
true-lst)
(tautologyp (caddr x)
true-lst false-lst))
((falsep (cadr x)
false-lst)
(tautologyp (cadddr x)
true-lst false-lst))
(else (and (tautologyp (caddr x)
(cons (cadr x)
true-lst)
false-lst)
(tautologyp (cadddr x)
true-lst
(cons (cadr x)
false-lst))))))
(else #f)))
(define if-constructor '*) ; becomes (symbol->symbol-record 'if)
(define rewrite-count 0) ; sanity check
; The next procedure is Henry Baker's sharing CONS, which avoids
; allocation if the result is already in hand.
; The REWRITE and REWRITE-ARGS procedures have been modified to
; use SCONS instead of CONS.
(define (scons x y original)
(if (and (eq? x (car original))
(eq? y (cdr original)))
original
(cons x y)))
(define (rewrite term)
(set! rewrite-count (+ rewrite-count 1))
(cond ((not (pair? term))
term)
(else (rewrite-with-lemmas (scons (car term)
(rewrite-args (cdr term))
term)
(get-lemmas (car term))))))
(define (rewrite-args lst)
(cond ((null? lst)
'())
(else (scons (rewrite (car lst))
(rewrite-args (cdr lst))
lst))))
(define (rewrite-with-lemmas term lst)
(cond ((null? lst)
term)
((one-way-unify term (cadr (car lst)))
(rewrite ( apply-subst unify-subst (caddr (car lst)))))
(else (rewrite-with-lemmas term (cdr lst)))))
(define unify-subst '*)
(define (one-way-unify term1 term2)
(begin (set! unify-subst '())
(one-way-unify1 term1 term2)))
(define (one-way-unify1 term1 term2)
(cond ((not (pair? term2))
(let ((temp-temp (assq term2 unify-subst)))
(cond (temp-temp
(term-equal? term1 (cdr temp-temp)))
((number? term2) ; This bug fix makes
(equal? term1 term2)) ; nboyer 10-25% slower!
(else
(set! unify-subst (cons (cons term2 term1)
unify-subst))
#t))))
((not (pair? term1))
#f)
((eq? (car term1)
(car term2))
(one-way-unify1-lst (cdr term1)
(cdr term2)))
(else #f)))
(define (one-way-unify1-lst lst1 lst2)
(cond ((null? lst1)
(null? lst2))
((null? lst2)
#f)
((one-way-unify1 (car lst1)
(car lst2))
(one-way-unify1-lst (cdr lst1)
(cdr lst2)))
(else #f)))
(define (falsep x lst)
(or (term-equal? x false-term)
(term-member? x lst)))
(define (truep x lst)
(or (term-equal? x true-term)
(term-member? x lst)))
(define false-term '*) ; becomes (translate-term '(f))
(define true-term '*) ; becomes (translate-term '(t))
; The next two procedures were in the original benchmark
; but were never used.
(define (trans-of-implies n)
(translate-term
(list (quote implies)
(trans-of-implies1 n)
(list (quote implies)
0 n))))
(define (trans-of-implies1 n)
(cond ((equal? n 1)
(list (quote implies)
0 1))
(else (list (quote and)
(list (quote implies)
(- n 1)
n)
(trans-of-implies1 (- n 1))))))
; Translated terms can be circular structures, which can't be
; compared using Scheme's equal? and member procedures, so we
; use these instead.
(define (term-equal? x y)
(cond ((pair? x)
(and (pair? y)
(symbol-record-equal? (car x) (car y))
(term-args-equal? (cdr x) (cdr y))))
(else (equal? x y))))
(define (term-args-equal? lst1 lst2)
(cond ((null? lst1)
(null? lst2))
((null? lst2)
#f)
((term-equal? (car lst1) (car lst2))
(term-args-equal? (cdr lst1) (cdr lst2)))
(else #f)))
(define (term-member? x lst)
(cond ((null? lst)
#f)
((term-equal? x (car lst))
#t)
(else (term-member? x (cdr lst)))))
(set! setup-boyer
(lambda ()
(set! *symbol-records-alist* '())
(set! if-constructor (symbol->symbol-record 'if))
(set! false-term (translate-term '(f)))
(set! true-term (translate-term '(t)))
(setup)))
(set! test-boyer
(lambda (n)
(set! rewrite-count 0)
(let ((answer (test n)))
(write rewrite-count)
(display " rewrites")
(newline)
(if answer
rewrite-count
#f)))))
(sboyer-benchmark 5)

2
collects/tests/mzscheme/benchmarks/common/sboyer.ss Normal file
View File

@ -0,0 +1,2 @@
(module sboyer "wrap.ss")

143
collects/tests/mzscheme/benchmarks/common/sort1.sch Normal file
View File

@ -0,0 +1,143 @@
; This benchmark uses the code for Larceny's standard sort procedure.
;
; Usage:
; (sort-benchmark sorter n)
;
; where
; sorter is a sort procedure (usually sort or sort1) whose calling
; convention is compatible with Larceny's
; n is the number of fixnums to sort
(define sort1
(let ()
;;; File : sort.scm
;;; Author : Richard A. O'Keefe (based on Prolog code by D.H.D.Warren)
;;; Updated: 11 June 1991
;
; $Id: sort.sch 264 1998-12-14 16:44:08Z lth $
;
; Code originally obtained from Scheme Repository, since hacked.
;
; Sort and Sort! will sort lists and vectors. The former returns a new
; data structure; the latter sorts the data structure in-place. A
; mergesort algorithm is used.
; Destructive merge of two sorted lists.
(define (merge!! a b less?)
(define (loop r a b)
(if (less? (car b) (car a))
(begin (set-cdr! r b)
(if (null? (cdr b))
(set-cdr! b a)
(loop b a (cdr b)) ))
;; (car a) <= (car b)
(begin (set-cdr! r a)
(if (null? (cdr a))
(set-cdr! a b)
(loop a (cdr a) b)) )) )
(cond ((null? a) b)
((null? b) a)
((less? (car b) (car a))
(if (null? (cdr b))
(set-cdr! b a)
(loop b a (cdr b)))
b)
(else ; (car a) <= (car b)
(if (null? (cdr a))
(set-cdr! a b)
(loop a (cdr a) b))
a)))
; Sort procedure which copies the input list and then sorts the
; new list imperatively. Due to Richard O'Keefe; algorithm
; attributed to D.H.D. Warren
(define (sort!! seq less?)
(define (step n)
(cond ((> n 2)
(let* ((j (quotient n 2))
(a (step j))
(k (- n j))
(b (step k)))
(merge!! a b less?)))
((= n 2)
(let ((x (car seq))
(y (cadr seq))
(p seq))
(set! seq (cddr seq))
(if (less? y x)
(begin
(set-car! p y)
(set-car! (cdr p) x)))
(set-cdr! (cdr p) '())
p))
((= n 1)
(let ((p seq))
(set! seq (cdr seq))
(set-cdr! p '())
p))
(else
'())))
(step (length seq)))
(define (sort! seq less?)
(cond ((null? seq)
seq)
((pair? seq)
(sort!! seq less?))
((vector? seq)
(do ((l (sort!! (vector->list seq) less?) (cdr l))
(i 0 (+ i 1)))
((null? l) seq)
(vector-set! seq i (car l))))
(else
(error "sort!: not a valid sequence: " seq))))
(define (sort seq less?)
(cond ((null? seq)
seq)
((pair? seq)
(sort!! (list-copy seq) less?))
((vector? seq)
(list->vector (sort!! (vector->list seq) less?)))
(else
(error "sort: not a valid sequence: " seq))))
; eof
; This is pretty much optimal for Larceny.
(define (list-copy l)
(define (loop l prev)
(if (null? l)
#t
(let ((q (cons (car l) '())))
(set-cdr! prev q)
(loop (cdr l) q))))
(if (null? l)
l
(let ((first (cons (car l) '())))
(loop (cdr l) first)
first)))
sort))
(define (rgen n m)
(let loop ((n n) (l '()))
(if (zero? n)
l
(loop (- n 1) (cons (random m) l)))))
(define (sort-benchmark sorter n)
(let ((l (rgen n 1000000)))
(time (sorter l <))))
(sort-benchmark sort1 1000000)

2
collects/tests/mzscheme/benchmarks/common/sort1.ss Normal file
View File

@ -0,0 +1,2 @@
(module sort1 "wrap.ss")

25
collects/tests/mzscheme/benchmarks/common/tak.sch Normal file
View File

@ -0,0 +1,25 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: tak.sch
; Description: TAK benchmark from the Gabriel tests
; Author: Richard Gabriel
; Created: 12-Apr-85
; Modified: 12-Apr-85 09:58:18 (Bob Shaw)
; 22-Jul-87 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;; TAK -- A vanilla version of the TAKeuchi function
(define (tak x y z)
(if (not (< y x))
z
(tak (tak (- x 1) y z)
(tak (- y 1) z x)
(tak (- z 1) x y))))
;;; call: (tak 18 12 6)
(time (tak 18 12 2))

2
collects/tests/mzscheme/benchmarks/common/tak.ss Normal file
View File

@ -0,0 +1,2 @@
(module tak "wrap.ss")

41
collects/tests/mzscheme/benchmarks/common/takl.sch Normal file
View File

@ -0,0 +1,41 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: takl.sch
; Description: TAKL benchmark from the Gabriel tests
; Author: Richard Gabriel
; Created: 12-Apr-85
; Modified: 12-Apr-85 10:07:00 (Bob Shaw)
; 22-Jul-87 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;; TAKL -- The TAKeuchi function using lists as counters.
(define (listn n)
(if (not (= 0 n))
(cons n (listn (- n 1)))
'()))
(define 18l (listn 18))
(define 12l (listn 12))
(define 6l (listn 2))
(define (mas x y z)
(if (not (shorterp y x))
z
(mas (mas (cdr x)
y z)
(mas (cdr y)
z x)
(mas (cdr z)
x y))))
(define (shorterp x y)
(and (not (null? y))
(or (null? x)
(shorterp (cdr x)
(cdr y)))))
;;; call: (mas 18l 12l 6l)
(time (mas 18l 12l 6l))

2
collects/tests/mzscheme/benchmarks/common/takl.ss Normal file
View File

@ -0,0 +1,2 @@
(module takl "wrap.ss")

521
collects/tests/mzscheme/benchmarks/common/takr.sch Normal file
View File

@ -0,0 +1,521 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: takr.sch
; Description: TAKR benchmark
; Author: Richard Gabriel
; Created: 12-Apr-85
; Modified: 12-Apr-85 10:12:43 (Bob Shaw)
; 22-Jul-87 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;; TAKR -- 100 function (count `em) version of TAK that tries to defeat cache
;;; memory effects. Results should be the same as for TAK on stack machines.
;;; Distribution of calls is not completely flat.
(define (tak0 x y z)
(cond ((not (< y x)) z)
(else (tak1 (tak37 (- x 1) y z)
(tak11 (- y 1) z x)
(tak17 (- z 1) x y)))))
(define (tak1 x y z)
(cond ((not (< y x)) z)
(else (tak2 (tak74 (- x 1) y z)
(tak22 (- y 1) z x)
(tak34 (- z 1) x y)))))
(define (tak2 x y z)
(cond ((not (< y x)) z)
(else (tak3 (tak11 (- x 1) y z)
(tak33 (- y 1) z x)
(tak51 (- z 1) x y)))))
(define (tak3 x y z)
(cond ((not (< y x)) z)
(else (tak4 (tak48 (- x 1) y z)
(tak44 (- y 1) z x)
(tak68 (- z 1) x y)))))
(define (tak4 x y z)
(cond ((not (< y x)) z)
(else (tak5 (tak85 (- x 1) y z)
(tak55 (- y 1) z x)
(tak85 (- z 1) x y)))))
(define (tak5 x y z)
(cond ((not (< y x)) z)
(else (tak6 (tak22 (- x 1) y z)
(tak66 (- y 1) z x)
(tak2 (- z 1) x y)))))
(define (tak6 x y z)
(cond ((not (< y x)) z)
(else (tak7 (tak59 (- x 1) y z)
(tak77 (- y 1) z x)
(tak19 (- z 1) x y)))))
(define (tak7 x y z)
(cond ((not (< y x)) z)
(else (tak8 (tak96 (- x 1) y z)
(tak88 (- y 1) z x)
(tak36 (- z 1) x y)))))
(define (tak8 x y z)
(cond ((not (< y x)) z)
(else (tak9 (tak33 (- x 1) y z)
(tak99 (- y 1) z x)
(tak53 (- z 1) x y)))))
(define (tak9 x y z)
(cond ((not (< y x)) z)
(else (tak10 (tak70 (- x 1) y z)
(tak10 (- y 1) z x)
(tak70 (- z 1) x y)))))
(define (tak10 x y z)
(cond ((not (< y x)) z)
(else (tak11 (tak7 (- x 1) y z)
(tak21 (- y 1) z x)
(tak87 (- z 1) x y)))))
(define (tak11 x y z)
(cond ((not (< y x)) z)
(else (tak12 (tak44 (- x 1) y z)
(tak32 (- y 1) z x)
(tak4 (- z 1) x y)))))
(define (tak12 x y z)
(cond ((not (< y x)) z)
(else (tak13 (tak81 (- x 1) y z)
(tak43 (- y 1) z x)
(tak21 (- z 1) x y)))))
(define (tak13 x y z)
(cond ((not (< y x)) z)
(else (tak14 (tak18 (- x 1) y z)
(tak54 (- y 1) z x)
(tak38 (- z 1) x y)))))
(define (tak14 x y z)
(cond ((not (< y x)) z)
(else (tak15 (tak55 (- x 1) y z)
(tak65 (- y 1) z x)
(tak55 (- z 1) x y)))))
(define (tak15 x y z)
(cond ((not (< y x)) z)
(else (tak16 (tak92 (- x 1) y z)
(tak76 (- y 1) z x)
(tak72 (- z 1) x y)))))
(define (tak16 x y z)
(cond ((not (< y x)) z)
(else (tak17 (tak29 (- x 1) y z)
(tak87 (- y 1) z x)
(tak89 (- z 1) x y)))))
(define (tak17 x y z)
(cond ((not (< y x)) z)
(else (tak18 (tak66 (- x 1) y z)
(tak98 (- y 1) z x)
(tak6 (- z 1) x y)))))
(define (tak18 x y z)
(cond ((not (< y x)) z)
(else (tak19 (tak3 (- x 1) y z)
(tak9 (- y 1) z x)
(tak23 (- z 1) x y)))))
(define (tak19 x y z)
(cond ((not (< y x)) z)
(else (tak20 (tak40 (- x 1) y z)
(tak20 (- y 1) z x)
(tak40 (- z 1) x y)))))
(define (tak20 x y z)
(cond ((not (< y x)) z)
(else (tak21 (tak77 (- x 1) y z)
(tak31 (- y 1) z x)
(tak57 (- z 1) x y)))))
(define (tak21 x y z)
(cond ((not (< y x)) z)
(else (tak22 (tak14 (- x 1) y z)
(tak42 (- y 1) z x)
(tak74 (- z 1) x y)))))
(define (tak22 x y z)
(cond ((not (< y x)) z)
(else (tak23 (tak51 (- x 1) y z)
(tak53 (- y 1) z x)
(tak91 (- z 1) x y)))))
(define (tak23 x y z)
(cond ((not (< y x)) z)
(else (tak24 (tak88 (- x 1) y z)
(tak64 (- y 1) z x)
(tak8 (- z 1) x y)))))
(define (tak24 x y z)
(cond ((not (< y x)) z)
(else (tak25 (tak25 (- x 1) y z)
(tak75 (- y 1) z x)
(tak25 (- z 1) x y)))))
(define (tak25 x y z)
(cond ((not (< y x)) z)
(else (tak26 (tak62 (- x 1) y z)
(tak86 (- y 1) z x)
(tak42 (- z 1) x y)))))
(define (tak26 x y z)
(cond ((not (< y x)) z)
(else (tak27 (tak99 (- x 1) y z)
(tak97 (- y 1) z x)
(tak59 (- z 1) x y)))))
(define (tak27 x y z)
(cond ((not (< y x)) z)
(else (tak28 (tak36 (- x 1) y z)
(tak8 (- y 1) z x)
(tak76 (- z 1) x y)))))
(define (tak28 x y z)
(cond ((not (< y x)) z)
(else (tak29 (tak73 (- x 1) y z)
(tak19 (- y 1) z x)
(tak93 (- z 1) x y)))))
(define (tak29 x y z)
(cond ((not (< y x)) z)
(else (tak30 (tak10 (- x 1) y z)
(tak30 (- y 1) z x)
(tak10 (- z 1) x y)))))
(define (tak30 x y z)
(cond ((not (< y x)) z)
(else (tak31 (tak47 (- x 1) y z)
(tak41 (- y 1) z x)
(tak27 (- z 1) x y)))))
(define (tak31 x y z)
(cond ((not (< y x)) z)
(else (tak32 (tak84 (- x 1) y z)
(tak52 (- y 1) z x)
(tak44 (- z 1) x y)))))
(define (tak32 x y z)
(cond ((not (< y x)) z)
(else (tak33 (tak21 (- x 1) y z)
(tak63 (- y 1) z x)
(tak61 (- z 1) x y)))))
(define (tak33 x y z)
(cond ((not (< y x)) z)
(else (tak34 (tak58 (- x 1) y z)
(tak74 (- y 1) z x)
(tak78 (- z 1) x y)))))
(define (tak34 x y z)
(cond ((not (< y x)) z)
(else (tak35 (tak95 (- x 1) y z)
(tak85 (- y 1) z x)
(tak95 (- z 1) x y)))))
(define (tak35 x y z)
(cond ((not (< y x)) z)
(else (tak36 (tak32 (- x 1) y z)
(tak96 (- y 1) z x)
(tak12 (- z 1) x y)))))
(define (tak36 x y z)
(cond ((not (< y x)) z)
(else (tak37 (tak69 (- x 1) y z)
(tak7 (- y 1) z x)
(tak29 (- z 1) x y)))))
(define (tak37 x y z)
(cond ((not (< y x)) z)
(else (tak38 (tak6 (- x 1) y z)
(tak18 (- y 1) z x)
(tak46 (- z 1) x y)))))
(define (tak38 x y z)
(cond ((not (< y x)) z)
(else (tak39 (tak43 (- x 1) y z)
(tak29 (- y 1) z x)
(tak63 (- z 1) x y)))))
(define (tak39 x y z)
(cond ((not (< y x)) z)
(else (tak40 (tak80 (- x 1) y z)
(tak40 (- y 1) z x)
(tak80 (- z 1) x y)))))
(define (tak40 x y z)
(cond ((not (< y x)) z)
(else (tak41 (tak17 (- x 1) y z)
(tak51 (- y 1) z x)
(tak97 (- z 1) x y)))))
(define (tak41 x y z)
(cond ((not (< y x)) z)
(else (tak42 (tak54 (- x 1) y z)
(tak62 (- y 1) z x)
(tak14 (- z 1) x y)))))
(define (tak42 x y z)
(cond ((not (< y x)) z)
(else (tak43 (tak91 (- x 1) y z)
(tak73 (- y 1) z x)
(tak31 (- z 1) x y)))))
(define (tak43 x y z)
(cond ((not (< y x)) z)
(else (tak44 (tak28 (- x 1) y z)
(tak84 (- y 1) z x)
(tak48 (- z 1) x y)))))
(define (tak44 x y z)
(cond ((not (< y x)) z)
(else (tak45 (tak65 (- x 1) y z)
(tak95 (- y 1) z x)
(tak65 (- z 1) x y)))))
(define (tak45 x y z)
(cond ((not (< y x)) z)
(else (tak46 (tak2 (- x 1) y z)
(tak6 (- y 1) z x)
(tak82 (- z 1) x y)))))
(define (tak46 x y z)
(cond ((not (< y x)) z)
(else (tak47 (tak39 (- x 1) y z)
(tak17 (- y 1) z x)
(tak99 (- z 1) x y)))))
(define (tak47 x y z)
(cond ((not (< y x)) z)
(else (tak48 (tak76 (- x 1) y z)
(tak28 (- y 1) z x)
(tak16 (- z 1) x y)))))
(define (tak48 x y z)
(cond ((not (< y x)) z)
(else (tak49 (tak13 (- x 1) y z)
(tak39 (- y 1) z x)
(tak33 (- z 1) x y)))))
(define (tak49 x y z)
(cond ((not (< y x)) z)
(else (tak50 (tak50 (- x 1) y z)
(tak50 (- y 1) z x)
(tak50 (- z 1) x y)))))
(define (tak50 x y z)
(cond ((not (< y x)) z)
(else (tak51 (tak87 (- x 1) y z)
(tak61 (- y 1) z x)
(tak67 (- z 1) x y)))))
(define (tak51 x y z)
(cond ((not (< y x)) z)
(else (tak52 (tak24 (- x 1) y z)
(tak72 (- y 1) z x)
(tak84 (- z 1) x y)))))
(define (tak52 x y z)
(cond ((not (< y x)) z)
(else (tak53 (tak61 (- x 1) y z)
(tak83 (- y 1) z x)
(tak1 (- z 1) x y)))))
(define (tak53 x y z)
(cond ((not (< y x)) z)
(else (tak54 (tak98 (- x 1) y z)
(tak94 (- y 1) z x)
(tak18 (- z 1) x y)))))
(define (tak54 x y z)
(cond ((not (< y x)) z)
(else (tak55 (tak35 (- x 1) y z)
(tak5 (- y 1) z x)
(tak35 (- z 1) x y)))))
(define (tak55 x y z)
(cond ((not (< y x)) z)
(else (tak56 (tak72 (- x 1) y z)
(tak16 (- y 1) z x)
(tak52 (- z 1) x y)))))
(define (tak56 x y z)
(cond ((not (< y x)) z)
(else (tak57 (tak9 (- x 1) y z)
(tak27 (- y 1) z x)
(tak69 (- z 1) x y)))))
(define (tak57 x y z)
(cond ((not (< y x)) z)
(else (tak58 (tak46 (- x 1) y z)
(tak38 (- y 1) z x)
(tak86 (- z 1) x y)))))
(define (tak58 x y z)
(cond ((not (< y x)) z)
(else (tak59 (tak83 (- x 1) y z)
(tak49 (- y 1) z x)
(tak3 (- z 1) x y)))))
(define (tak59 x y z)
(cond ((not (< y x)) z)
(else (tak60 (tak20 (- x 1) y z)
(tak60 (- y 1) z x)
(tak20 (- z 1) x y)))))
(define (tak60 x y z)
(cond ((not (< y x)) z)
(else (tak61 (tak57 (- x 1) y z)
(tak71 (- y 1) z x)
(tak37 (- z 1) x y)))))
(define (tak61 x y z)
(cond ((not (< y x)) z)
(else (tak62 (tak94 (- x 1) y z)
(tak82 (- y 1) z x)
(tak54 (- z 1) x y)))))
(define (tak62 x y z)
(cond ((not (< y x)) z)
(else (tak63 (tak31 (- x 1) y z)
(tak93 (- y 1) z x)
(tak71 (- z 1) x y)))))
(define (tak63 x y z)
(cond ((not (< y x)) z)
(else (tak64 (tak68 (- x 1) y z)
(tak4 (- y 1) z x)
(tak88 (- z 1) x y)))))
(define (tak64 x y z)
(cond ((not (< y x)) z)
(else (tak65 (tak5 (- x 1) y z)
(tak15 (- y 1) z x)
(tak5 (- z 1) x y)))))
(define (tak65 x y z)
(cond ((not (< y x)) z)
(else (tak66 (tak42 (- x 1) y z)
(tak26 (- y 1) z x)
(tak22 (- z 1) x y)))))
(define (tak66 x y z)
(cond ((not (< y x)) z)
(else (tak67 (tak79 (- x 1) y z)
(tak37 (- y 1) z x)
(tak39 (- z 1) x y)))))
(define (tak67 x y z)
(cond ((not (< y x)) z)
(else (tak68 (tak16 (- x 1) y z)
(tak48 (- y 1) z x)
(tak56 (- z 1) x y)))))
(define (tak68 x y z)
(cond ((not (< y x)) z)
(else (tak69 (tak53 (- x 1) y z)
(tak59 (- y 1) z x)
(tak73 (- z 1) x y)))))
(define (tak69 x y z)
(cond ((not (< y x)) z)
(else (tak70 (tak90 (- x 1) y z)
(tak70 (- y 1) z x)
(tak90 (- z 1) x y)))))
(define (tak70 x y z)
(cond ((not (< y x)) z)
(else (tak71 (tak27 (- x 1) y z)
(tak81 (- y 1) z x)
(tak7 (- z 1) x y)))))
(define (tak71 x y z)
(cond ((not (< y x)) z)
(else (tak72 (tak64 (- x 1) y z)
(tak92 (- y 1) z x)
(tak24 (- z 1) x y)))))
(define (tak72 x y z)
(cond ((not (< y x)) z)
(else (tak73 (tak1 (- x 1) y z)
(tak3 (- y 1) z x)
(tak41 (- z 1) x y)))))
(define (tak73 x y z)
(cond ((not (< y x)) z)
(else (tak74 (tak38 (- x 1) y z)
(tak14 (- y 1) z x)
(tak58 (- z 1) x y)))))
(define (tak74 x y z)
(cond ((not (< y x)) z)
(else (tak75 (tak75 (- x 1) y z)
(tak25 (- y 1) z x)
(tak75 (- z 1) x y)))))
(define (tak75 x y z)
(cond ((not (< y x)) z)
(else (tak76 (tak12 (- x 1) y z)
(tak36 (- y 1) z x)
(tak92 (- z 1) x y)))))
(define (tak76 x y z)
(cond ((not (< y x)) z)
(else (tak77 (tak49 (- x 1) y z)
(tak47 (- y 1) z x)
(tak9 (- z 1) x y)))))
(define (tak77 x y z)
(cond ((not (< y x)) z)
(else (tak78 (tak86 (- x 1) y z)
(tak58 (- y 1) z x)
(tak26 (- z 1) x y)))))
(define (tak78 x y z)
(cond ((not (< y x)) z)
(else (tak79 (tak23 (- x 1) y z)
(tak69 (- y 1) z x)
(tak43 (- z 1) x y)))))
(define (tak79 x y z)
(cond ((not (< y x)) z)
(else (tak80 (tak60 (- x 1) y z)
(tak80 (- y 1) z x)
(tak60 (- z 1) x y)))))
(define (tak80 x y z)
(cond ((not (< y x)) z)
(else (tak81 (tak97 (- x 1) y z)
(tak91 (- y 1) z x)
(tak77 (- z 1) x y)))))
(define (tak81 x y z)
(cond ((not (< y x)) z)
(else (tak82 (tak34 (- x 1) y z)
(tak2 (- y 1) z x)
(tak94 (- z 1) x y)))))
(define (tak82 x y z)
(cond ((not (< y x)) z)
(else (tak83 (tak71 (- x 1) y z)
(tak13 (- y 1) z x)
(tak11 (- z 1) x y)))))
(define (tak83 x y z)
(cond ((not (< y x)) z)
(else (tak84 (tak8 (- x 1) y z)
(tak24 (- y 1) z x)
(tak28 (- z 1) x y)))))
(define (tak84 x y z)
(cond ((not (< y x)) z)
(else (tak85 (tak45 (- x 1) y z)
(tak35 (- y 1) z x)
(tak45 (- z 1) x y)))))
(define (tak85 x y z)
(cond ((not (< y x)) z)
(else (tak86 (tak82 (- x 1) y z)
(tak46 (- y 1) z x)
(tak62 (- z 1) x y)))))
(define (tak86 x y z)
(cond ((not (< y x)) z)
(else (tak87 (tak19 (- x 1) y z)
(tak57 (- y 1) z x)
(tak79 (- z 1) x y)))))
(define (tak87 x y z)
(cond ((not (< y x)) z)
(else (tak88 (tak56 (- x 1) y z)
(tak68 (- y 1) z x)
(tak96 (- z 1) x y)))))
(define (tak88 x y z)
(cond ((not (< y x)) z)
(else (tak89 (tak93 (- x 1) y z)
(tak79 (- y 1) z x)
(tak13 (- z 1) x y)))))
(define (tak89 x y z)
(cond ((not (< y x)) z)
(else (tak90 (tak30 (- x 1) y z)
(tak90 (- y 1) z x)
(tak30 (- z 1) x y)))))
(define (tak90 x y z)
(cond ((not (< y x)) z)
(else (tak91 (tak67 (- x 1) y z)
(tak1 (- y 1) z x)
(tak47 (- z 1) x y)))))
(define (tak91 x y z)
(cond ((not (< y x)) z)
(else (tak92 (tak4 (- x 1) y z)
(tak12 (- y 1) z x)
(tak64 (- z 1) x y)))))
(define (tak92 x y z)
(cond ((not (< y x)) z)
(else (tak93 (tak41 (- x 1) y z)
(tak23 (- y 1) z x)
(tak81 (- z 1) x y)))))
(define (tak93 x y z)
(cond ((not (< y x)) z)
(else (tak94 (tak78 (- x 1) y z)
(tak34 (- y 1) z x)
(tak98 (- z 1) x y)))))
(define (tak94 x y z)
(cond ((not (< y x)) z)
(else (tak95 (tak15 (- x 1) y z)
(tak45 (- y 1) z x)
(tak15 (- z 1) x y)))))
(define (tak95 x y z)
(cond ((not (< y x)) z)
(else (tak96 (tak52 (- x 1) y z)
(tak56 (- y 1) z x)
(tak32 (- z 1) x y)))))
(define (tak96 x y z)
(cond ((not (< y x)) z)
(else (tak97 (tak89 (- x 1) y z)
(tak67 (- y 1) z x)
(tak49 (- z 1) x y)))))
(define (tak97 x y z)
(cond ((not (< y x)) z)
(else (tak98 (tak26 (- x 1) y z)
(tak78 (- y 1) z x)
(tak66 (- z 1) x y)))))
(define (tak98 x y z)
(cond ((not (< y x)) z)
(else (tak99 (tak63 (- x 1) y z)
(tak89 (- y 1) z x)
(tak83 (- z 1) x y)))))
(define (tak99 x y z)
(cond ((not (< y x)) z)
(else (tak0 (tak0 (- x 1) y z)
(tak0 (- y 1) z x)
(tak0 (- z 1) x y)))))
;;; call: (tak0 18 12 6)
(time (tak0 18 12 2))

2
collects/tests/mzscheme/benchmarks/common/takr.ss Normal file
View File

@ -0,0 +1,2 @@
(module takr "wrap.ss")

158
collects/tests/mzscheme/benchmarks/common/traverse.sch Normal file
View File

@ -0,0 +1,158 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: traverse.sch
; Description: TRAVERSE benchmark
; Author: Richard Gabriel
; Created: 12-Apr-85
; Modified: 12-Apr-85 10:24:04 (Bob Shaw)
; 9-Aug-87 (Will Clinger)
; Language: Scheme (but see note)
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; Note: This benchmark may depend upon the empty list being the same
; as #f.
;;; TRAVERSE -- Benchmark which creates and traverses a tree structure.
(define (make-node)
(let ((node (make-vector 11 '())))
(vector-set! node 0 'node)
(vector-set! node 3 (snb))
node))
(define (node-parents node) (vector-ref node 1))
(define (node-sons node) (vector-ref node 2))
(define (node-sn node) (vector-ref node 3))
(define (node-entry1 node) (vector-ref node 4))
(define (node-entry2 node) (vector-ref node 5))
(define (node-entry3 node) (vector-ref node 6))
(define (node-entry4 node) (vector-ref node 7))
(define (node-entry5 node) (vector-ref node 8))
(define (node-entry6 node) (vector-ref node 9))
(define (node-mark node) (vector-ref node 10))
(define (node-parents-set! node v) (vector-set! node 1 v))
(define (node-sons-set! node v) (vector-set! node 2 v))
(define (node-sn-set! node v) (vector-set! node 3 v))
(define (node-entry1-set! node v) (vector-set! node 4 v))
(define (node-entry2-set! node v) (vector-set! node 5 v))
(define (node-entry3-set! node v) (vector-set! node 6 v))
(define (node-entry4-set! node v) (vector-set! node 7 v))
(define (node-entry5-set! node v) (vector-set! node 8 v))
(define (node-entry6-set! node v) (vector-set! node 9 v))
(define (node-mark-set! node v) (vector-set! node 10 v))
(define *sn* 0)
(define *rand* 21)
(define *count* 0)
(define *marker* #f)
(define *root* '())
(define (snb)
(set! *sn* (+ 1 *sn*))
*sn*)
(define (seed)
(set! *rand* 21)
*rand*)
(define (traverse-random)
(set! *rand* (remainder (* *rand* 17) 251))
*rand*)
(define (traverse-remove n q)
(cond ((eq? (cdr (car q)) (car q))
(let ((x (caar q))) (set-car! q #f) x))
((zero? n)
(let ((x (caar q)))
(do ((p (car q) (cdr p)))
((eq? (cdr p) (car q))
(set-cdr! p (cdr (car q)))
(set-car! q p)))
x))
(else (do ((n n (- n 1))
(q (car q) (cdr q))
(p (cdr (car q)) (cdr p)))
((zero? n) (let ((x (car q))) (set-cdr! q p) x))))))
(define (traverse-select n q)
(do ((n n (- n 1))
(q (car q) (cdr q)))
((zero? n) (car q))))
(define (add a q)
(cond ((null? q)
`(,(let ((x `(,a)))
(set-cdr! x x) x)))
((null? (car q))
(let ((x `(,a)))
(set-cdr! x x)
(set-car! q x)
q))
; the CL version had a useless set-car! in the next line (wc)
(else (set-cdr! (car q) `(,a . ,(cdr (car q))))
q)))
(define (create-structure n)
(let ((a `(,(make-node))))
(do ((m (- n 1) (- m 1))
(p a))
((zero? m)
(set! a `(,(begin (set-cdr! p a) p)))
(do ((unused a)
(used (add (traverse-remove 0 a) #f))
(x 0)
(y 0))
((null? (car unused))
(find-root (traverse-select 0 used) n))
(set! x (traverse-remove (remainder (traverse-random) n) unused))
(set! y (traverse-select (remainder (traverse-random) n) used))
(add x used)
(node-sons-set! y `(,x . ,(node-sons y)))
(node-parents-set! x `(,y . ,(node-parents x))) ))
(set! a (cons (make-node) a)))))
(define (find-root node n)
(do ((n n (- n 1)))
((or (zero? n) (null? (node-parents node)))
node)
(set! node (car (node-parents node)))))
(define (travers node mark)
(cond ((eq? (node-mark node) mark) #f)
(else (node-mark-set! node mark)
(set! *count* (+ 1 *count*))
(node-entry1-set! node (not (node-entry1 node)))
(node-entry2-set! node (not (node-entry2 node)))
(node-entry3-set! node (not (node-entry3 node)))
(node-entry4-set! node (not (node-entry4 node)))
(node-entry5-set! node (not (node-entry5 node)))
(node-entry6-set! node (not (node-entry6 node)))
(do ((sons (node-sons node) (cdr sons)))
((null? sons) #f)
(travers (car sons) mark)))))
(define (traverse root)
(let ((*count* 0))
(travers root (begin (set! *marker* (not *marker*)) *marker*))
*count*))
(define (init-traverse) ; Changed from defmacro to defun \bs
(set! *root* (create-structure 100))
#f)
(define (run-traverse) ; Changed from defmacro to defun \bs
(do ((i 50 (- i 1)))
((zero? i))
(traverse *root*)
(traverse *root*)
(traverse *root*)
(traverse *root*)
(traverse *root*)))
;;; to initialize, call: (init-traverse)
;;; to run traverse, call: (run-traverse)
(time (init-traverse))
(time (run-traverse))

84
collects/tests/mzscheme/benchmarks/common/triangle.sch Normal file
View File

@ -0,0 +1,84 @@
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
; File: triangle.sch
; Description: TRIANGLE benchmark
; Author: Richard Gabriel
; Created: 12-Apr-85
; Modified: 12-Apr-85 10:30:32 (Bob Shaw)
; 11-Aug-87 (Will Clinger)
; 22-Jan-88 (Will Clinger)
; Language: Scheme
; Status: Public Domain
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;; TRIANG -- Board game benchmark.
(define *board* (make-vector 16 1))
(define *sequence* (make-vector 14 0))
(define *a* (make-vector 37))
(for-each (lambda (i x) (vector-set! *a* i x))
'(0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36)
'(1 2 4 3 5 6 1 3 6 2 5 4 11 12
13 7 8 4 4 7 11 8 12 13 6 10
15 9 14 13 13 14 15 9 10
6 6))
(define *b* (make-vector 37))
(for-each (lambda (i x) (vector-set! *b* i x))
'(0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36)
'(2 4 7 5 8 9 3 6 10 5 9 8
12 13 14 8 9 5 2 4 7 5 8
9 3 6 10 5 9 8 12 13 14
8 9 5 5))
(define *c* (make-vector 37))
(for-each (lambda (i x) (vector-set! *c* i x))
'(0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36)
'(4 7 11 8 12 13 6 10 15 9 14 13
13 14 15 9 10 6 1 2 4 3 5 6 1
3 6 2 5 4 11 12 13 7 8 4 4))
(define *answer* '())
(define *final* '())
(vector-set! *board* 5 0)
(define (last-position)
(do ((i 1 (+ i 1)))
((or (= i 16) (= 1 (vector-ref *board* i)))
(if (= i 16) 0 i))))
(define (try i depth)
(cond ((= depth 14)
(let ((lp (last-position)))
(if (not (member lp *final*))
(set! *final* (cons lp *final*))))
(set! *answer*
(cons (cdr (vector->list *sequence*)) *answer*))
#t)
((and (= 1 (vector-ref *board* (vector-ref *a* i)))
(= 1 (vector-ref *board* (vector-ref *b* i)))
(= 0 (vector-ref *board* (vector-ref *c* i))))
(vector-set! *board* (vector-ref *a* i) 0)
(vector-set! *board* (vector-ref *b* i) 0)
(vector-set! *board* (vector-ref *c* i) 1)
(vector-set! *sequence* depth i)
(do ((j 0 (+ j 1))
(depth (+ depth 1)))
((or (= j 36) (try j depth)) #f))
(vector-set! *board* (vector-ref *a* i) 1)
(vector-set! *board* (vector-ref *b* i) 1)
(vector-set! *board* (vector-ref *c* i) 0) '())
(else #f)))
(define (gogogo i)
(let ((*answer* '())
(*final* '()))
(try i 1)))
;;; call: (gogogo 22))
(time (let loop ([n 10000])
(if (zero? n)
'done
(begin
(gogogo 22)
(loop (sub1 n))))))

2
collects/tests/mzscheme/benchmarks/common/triangle.ss Normal file
View File

@ -0,0 +1,2 @@
(module triangle "wrap.ss")

7
collects/tests/mzscheme/benchmarks/common/wrap.ss Normal file
View File

@ -0,0 +1,7 @@
(module wrap mzscheme
(provide (rename module-begin #%module-begin))
(require (lib "include.ss"))
(define-syntax (module-begin stx)
(let ([name (syntax-property stx 'enclosing-module-name)])
#`(#%plain-module-begin (include #,(format "~a.sch" name))))))

11
collects/tests/mzscheme/benchmarks/mz/expand-class.scm Normal file
View File

@ -0,0 +1,11 @@
(let ([dir (build-path (collection-path "mzlib")
"private")])
(with-input-from-file (build-path dir "class-internal.ss")
(lambda ()
(parameterize ([current-load-relative-directory dir])
(let ([s (read-syntax)])
(time (compile s)))))))

12
collects/tests/mzscheme/benchmarks/mz/input.xml Normal file
View File

File diff suppressed because one or more lines are too long

43
collects/tests/mzscheme/benchmarks/mz/parsing.scm Normal file
View File

@ -0,0 +1,43 @@
(require (lib "scheme-lexer.ss" "syntax-color"))
(define path "~/proj/plt/collects/framework/private/frame.ss")
(define content
(with-input-from-file path
(lambda ()
(read-bytes (file-size path)))))
(define e (make-object text%))
(send e load-file path)
(define (mk-p)
;#;
(open-input-text-editor e)
#;
(open-input-bytes content)
#;
(open-input-string (send e get-text 0 'eof)))
(let loop ([n 10])
(unless (zero? n)
(printf "lexing~n")
(time
(let ([p (mk-p)])
(port-count-lines! p)
(time
(let loop ()
(let-values ([(a b c d e) (scheme-lexer p)])
(unless (eq? 'eof b)
(loop)))))))
(printf "reading~n")
(time
(let ([p (mk-p)])
(port-count-lines! p)
(time
(let loop ()
(let ([v (read p)])
(unless (eof-object? v)
(loop)))))))
(printf "done~n")
(loop (sub1 n))))

6
collects/tests/mzscheme/benchmarks/mz/redsem.scm Normal file
View File

@ -0,0 +1,6 @@
(require (planet "beginner.ss" ("robby" "redex.plt") "examples"))
(collect-garbage)
(printf "Now\n")
(time (begin
(run-tests) (run-tests) (run-tests) (run-tests) (run-tests)
))

8
collects/tests/mzscheme/benchmarks/mz/ssax.scm Normal file
View File

@ -0,0 +1,8 @@
(require (planet "ssax.ss" ("lizorkin" "ssax.plt" 1 3)))
(collect-garbage)
(time (void (ssax:xml->sxml
(open-input-file (build-path
(current-load-relative-directory)
"input.xml"))
null)))

4
collects/tests/mzscheme/benchmarks/shootout/README.txt Normal file
View File

@ -0,0 +1,4 @@
The program "run" should kknow how to run each benchmark with its
standard input value. So run <benchmark.ss> like this:
mzscheme -qu run.ss <benchmark.ss>

13
collects/tests/mzscheme/benchmarks/shootout/ackermann.ss Normal file
View File

@ -0,0 +1,13 @@
(module ackermann mzscheme
(define (ack m n)
(cond ((zero? m) (+ n 1))
((zero? n) (ack (- m 1) 1))
(else (ack (- m 1) (ack m (- n 1))))))
(define (main args)
(let ((n (if (= (vector-length args) 0)
1
(string->number (vector-ref args 0)))))
(printf "Ack(3,~a): ~a~n" n (ack 3 n))))
(main (current-command-line-arguments)))

21
collects/tests/mzscheme/benchmarks/shootout/ary.ss Normal file
View File

@ -0,0 +1,21 @@
(module ary mzscheme
(define (main args)
(let* ((n (if (= (vector-length args) 0)
1
(string->number (vector-ref args 0))))
(x (make-vector n 0))
(y (make-vector n 0))
(last (- n 1)))
(do ((i 0 (+ i 1)))
((= i n))
(vector-set! x i (+ i 1)))
(do ((k 0 (+ k 1)))
((= k 1000))
(do ((i last (- i 1)))
((< i 0))
(vector-set! y i (+ (vector-ref x i) (vector-ref y i)))))
(print-list (vector-ref y 0) " " (vector-ref y last))))
(define (print-list . items) (for-each display items) (newline))
(main (current-command-line-arguments)))

45
collects/tests/mzscheme/benchmarks/shootout/binarytrees.ss Normal file
View File

@ -0,0 +1,45 @@
;;; The Great Computer Language Shootout
;;; http://shootout.alioth.debian.org/
;;; Derived from the Chicken variant by Sven Hartrumpf
(module binarytrees mzscheme
(define-struct node (left val right))
(define-struct leaf (val))
(define (make item d)
(if (= d 0)
(make-leaf item)
(let ((item2 (* item 2))
(d2 (- d 1)))
(make-node (make (- item2 1) d2) item (make item2 d2)))))
(define (check t)
(if (leaf? t)
(leaf-val t)
(+ (node-val t) (- (check (node-left t)) (check (node-right t))))))
(define (main argv)
(let* ((min-depth 4)
(max-depth (max (+ min-depth 2) (string->number (vector-ref argv 0)))))
(let ((stretch-depth (+ max-depth 1)))
(printf "stretch tree of depth ~a\t check: ~a\n"
stretch-depth
(check (make 0 stretch-depth))))
(let ((long-lived-tree (make 0 max-depth)))
(do ((d 4 (+ d 2))
(c 0 0))
((> d max-depth))
(let ((iterations (arithmetic-shift 1 (+ (- max-depth d) min-depth))))
(do ((i 0 (+ i 1)))
((>= i iterations))
(set! c (+ c (check (make i d)) (check (make (- i) d)))))
(printf "~a\t trees of depth ~a\t check: ~a\n"
(* 2 iterations)
d
c)))
(printf "long lived tree of depth ~a\t check: ~a\n"
max-depth
(check long-lived-tree)))))
(main (current-command-line-arguments)))

55
collects/tests/mzscheme/benchmarks/shootout/chameneos.ss Normal file
View File

@ -0,0 +1,55 @@
;;; The Great Computer Language Shootout
;;; http://shootout.alioth.debian.org/
(module chameneos mzscheme
(define (change c1 c2)
(case c1
[(red)
(case c2 [(blue) 'yellow] [(yellow) 'blue] [else c1])]
[(yellow)
(case c2 [(blue) 'red] [(red) 'blue] [else c1])]
[(blue)
(case c2 [(yellow) 'red] [(red) 'yellow] [else c1])]))
(define (place meeting-ch n)
(thread
(lambda ()
(let loop ([n n])
(if (zero? n)
;; Fade all:
(let loop ()
(let ([c (channel-get meeting-ch)])
(channel-put (car c) #f)
(loop)))
;; Let two meet:
(let ([c1 (channel-get meeting-ch)]
[c2 (channel-get meeting-ch)])
(channel-put (car c1) (cdr c2))
(channel-put (car c2) (cdr c1))
(loop (sub1 n))))))))
(define (creature color meeting-ch result-ch)
(thread
(lambda ()
(let ([ch (make-channel)])
(let loop ([color color][met 0])
(channel-put meeting-ch (cons ch color))
(let ([other-color (channel-get ch)])
(if other-color
;; Meet:
(loop (change color other-color) (add1 met))
;; Done:
(channel-put result-ch met))))))))
(let ([result-ch (make-channel)]
[meeting-ch (make-channel)])
(place meeting-ch (string->number (vector-ref (current-command-line-arguments) 0)))
(creature 'blue meeting-ch result-ch)
(creature 'red meeting-ch result-ch)
(creature 'yellow meeting-ch result-ch)
(creature 'blue meeting-ch result-ch)
(printf "~a\n" (+ (channel-get result-ch)
(channel-get result-ch)
(channel-get result-ch)
(channel-get result-ch)))))

24
collects/tests/mzscheme/benchmarks/shootout/cheapconcurrency.ss Normal file
View File

@ -0,0 +1,24 @@
(module cheapconcurrency mzscheme
(define (generate receive-ch n)
(if (zero? n)
receive-ch
(let ([ch (make-channel)])
(thread (lambda ()
(let loop ()
(channel-put ch (add1 (channel-get receive-ch)))
(loop))))
(generate ch (sub1 n)))))
(let ([n (string->number
(vector-ref (current-command-line-arguments) 0))])
(let* ([start-ch (make-channel)]
[end-ch (generate start-ch 500)])
(let loop ([n n][total 0])
(if (zero? n)
(printf "~a\n" total)
(begin
(channel-put start-ch 0)
(loop (sub1 n)
(+ total (channel-get end-ch)))))))))

45
collects/tests/mzscheme/benchmarks/shootout/echo.ss Normal file
View File

@ -0,0 +1,45 @@
(module echo mzscheme
(define PORT 8888)
(define DATA "Hello there sailor\n")
(define n 10)
(define (server)
(thread client)
(let-values ([(in out) (tcp-accept (tcp-listen PORT 5 #t))]
[(buffer) (make-string (string-length DATA))])
(file-stream-buffer-mode out 'none)
(let loop ([i (read-string! buffer in)]
[bytes 0])
(if (not (eof-object? i))
(begin
(display buffer out)
(loop (read-string! buffer in)
(+ bytes (string-length buffer))))
(begin
(display "server processed ")
(display bytes)
(display " bytes\n"))))))
(define (client)
(let-values ([(in out) (tcp-connect "127.0.0.1" PORT)]
[(buffer) (make-string (string-length DATA))])
(file-stream-buffer-mode out 'none)
(let loop ([n n])
(if (> n 0)
(begin
(display DATA out)
(let ([i (read-string! buffer in)])
(begin
(if (equal? DATA buffer)
(loop (- n 1))
'error))))
(close-output-port out)))))
(define (main args)
(set! n
(if (= (vector-length args) 0)
1
(string->number (vector-ref args 0))))
(server))
(main (current-command-line-arguments)))

36
collects/tests/mzscheme/benchmarks/shootout/except.ss Normal file
View File

@ -0,0 +1,36 @@
(module except mzscheme
(define HI 0)
(define LO 0)
(define (hi-excp? x) (eq? x 'Hi_Exception))
(define (lo-excp? x) (eq? x 'Lo_Exception))
(define (true? x) (if (boolean? x) x #t))
(define (some_fun n)
(with-handlers
([true? (lambda (exn) #f)])
(hi_fun n)))
(define (hi_fun n)
(with-handlers
([hi-excp? (lambda (exn) (set! HI (+ HI 1))) ])
(lo_fun n)))
(define (lo_fun n)
(with-handlers
([lo-excp? (lambda (exn) (set! LO (+ LO 1))) ])
(blowup n)))
(define (blowup n)
(if (= 0 (modulo n 2))
(raise 'Hi_Exception)
(raise 'Lo_Exception)))
(define (main args)
(let* ((n (if (= (vector-length args) 1) (string->number (vector-ref args 0)) 1)))
(do ((i 0 (+ i 1)))
((= i n))
(some_fun i)))
(printf "Exceptions: HI=~a / LO=~a~n" HI LO))
(main (current-command-line-arguments)))

86
collects/tests/mzscheme/benchmarks/shootout/fannkuch.ss Normal file
View File

@ -0,0 +1,86 @@
#!/usr/bin/mzscheme -qu
;; fannkuch benchmark for The Computer Language Shootout
;; Written by Dima Dorfman, 2004
;; Slightly improved by Sven Hartrumpf, 2005-2006
;;
;; Ever-so-slightly tweaked for MzScheme by Brent Fulgham
(module fannkuch mzscheme
(define vector-for-each (lambda (pred v)
(do ((i 0 (add1 i))
(v-length (vector-length v)))
((>= i v-length))
(pred (vector-ref v i)))))
(define (vector-reverse-slice! v i j)
(do ((i i (add1 i))
(j (sub1 j) (sub1 j))) ; exclude position j
((<= j i))
(vector-swap! v i j)))
(define (vector-swap! v i j)
(let ((t (vector-ref v i)))
(vector-set! v i (vector-ref v j))
(vector-set! v j t)))
(define (count-flips pi)
(do ((rho (vector-copy pi))
(i 0 (add1 i)))
((= (vector-ref rho 0) 0) i)
(vector-reverse-slice! rho 0 (add1 (vector-ref rho 0)))))
(define (vector-copy source)
(do ((vec (make-vector (vector-length source)))
(i 0 (add1 i)))
((= i (vector-length source)) vec)
(vector-set! vec i (vector-ref source i))))
(define (fannkuch n)
(let ((pi (do ((pi (make-vector n))
(i 0 (add1 i)))
((= i n) pi)
(vector-set! pi i i)))
(r n)
(count (make-vector n)))
(let loop ((flips 0)
(perms 0))
(cond ((< perms 30)
(vector-for-each (lambda (x)
(display (add1 x)))
pi)
(newline)))
(do ()
((= r 1))
(vector-set! count (sub1 r) r)
(set! r (sub1 r)))
(let ((flips2 (max (count-flips pi) flips)))
(let ((result
(let loop2 ()
(if (= r n)
flips2
(let ((perm0 (vector-ref pi 0)))
(do ((i 0))
((>= i r))
(let ((j (add1 i)))
(vector-set! pi i (vector-ref pi j))
(set! i j)))
(vector-set! pi r perm0)
(vector-set! count r (sub1 (vector-ref count r)))
(cond ((<= (vector-ref count r) 0)
(set! r (add1 r))
(loop2))
(else
#f)))))))
(or result
(loop flips2 (add1 perms)))
)))))
(define (main args)
(if (< (vector-length args) 1)
(begin (display "An argument is required") (newline) 2)
(let ((n (string->number (vector-ref args 0))))
(if (not (integer? n))
(begin (display "An integer is required") (newline) 2)
(printf "Pfannkuchen(~S) = ~S~%" n (fannkuch n))))))
(main (current-command-line-arguments)))

119
collects/tests/mzscheme/benchmarks/shootout/fasta.ss Normal file
View File

@ -0,0 +1,119 @@
;; The Great Computer Language Shootout
;; http://shootout.alioth.debian.org/
;;
;; fasta - benchmark
;;
;; Derived from the Chicken variant, which was
;; Contributed by Anthony Borla
(module fasta mzscheme
(define +alu+
(bytes-append
#"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
#"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
#"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
#"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
#"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"
#"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
#"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"))
(define +iub+
(list
'(#\a . 0.27) '(#\c . 0.12) '(#\g . 0.12) '(#\t . 0.27) '(#\B . 0.02)
'(#\D . 0.02) '(#\H . 0.02) '(#\K . 0.02) '(#\M . 0.02) '(#\N . 0.02)
'(#\R . 0.02) '(#\S . 0.02) '(#\V . 0.02) '(#\W . 0.02) '(#\Y . 0.02)))
(define +homosapien+
(list
'(#\a . 0.3029549426680) '(#\c . 0.1979883004921)
'(#\g . 0.1975473066391) '(#\t . 0.3015094502008)))
;; -------------
(define +line-size+ 60)
;; -------------------------------
(define (make-random seed)
(let* ((ia 3877) (ic 29573) (im 139968) (last seed))
(lambda (max)
(set! last (modulo (+ ic (* last ia)) im))
(/ (* max last) im) )))
;; -------------------------------
(define (make-cumulative-table frequency-table)
(let ((cumulative 0.0))
(map
(lambda (x)
(set! cumulative (+ cumulative (cdr x)))
(cons (char->integer (car x)) cumulative))
frequency-table)))
;; -------------
(define random-next (make-random 42))
(define +segmarker+ ">")
;; -------------
(define (select-random cumulative-table)
(let ((rvalue (random-next 1.0)))
(select-over-threshold rvalue cumulative-table)))
(define (select-over-threshold rvalue table)
(if (<= rvalue (cdar table))
(caar table)
(select-over-threshold rvalue (cdr table))))
;; -------------
(define (repeat-fasta id desc n_ sequence line-length)
(let ((seqlen (bytes-length sequence))
(out (current-output-port)))
(display (string-append +segmarker+ id " " desc "\n") out)
(let loop-o ((n n_) (k 0))
(unless (<= n 0)
(let ((m (min n line-length)))
(let loop-i ((i 0) (k k))
(if (>= i m)
(begin
(newline out)
(loop-o (- n line-length) k))
(let ([k (if (= k seqlen) 0 k)])
(write-byte (bytes-ref sequence k) out)
(loop-i (add1 i) (add1 k))))))))))
;; -------------
(define (random-fasta id desc n_ cumulative-table line-length)
(let ((out (current-output-port)))
(display (string-append +segmarker+ id " " desc "\n") out)
(let loop-o ((n n_))
(unless (<= n 0)
(let ((m (min n line-length)))
(let loop-i ((i 0))
(unless (>= i m)
(write-byte (select-random cumulative-table) out)
(loop-i (add1 i))))
(newline out)
(loop-o (- n line-length)))))))
;; -------------------------------
(define (main args)
(let ((n (string->number (vector-ref args 0))))
(repeat-fasta "ONE" "Homo sapiens alu" (* n 2) +alu+ +line-size+)
(random-fasta "TWO" "IUB ambiguity codes" (* n 3)
(make-cumulative-table +iub+) +line-size+)
(random-fasta "THREE" "Homo sapiens frequency" (* n 5)
(make-cumulative-table +homosapien+) +line-size+) ))
;; -------------------------------
(main (current-command-line-arguments)))

13
collects/tests/mzscheme/benchmarks/shootout/fibo.ss Normal file
View File

@ -0,0 +1,13 @@
(module fibo mzscheme
(define (fib n)
(cond ((< n 2) 1)
(else (+ (fib (- n 2)) (fib (- n 1))))))
(define (main args)
(let ((n (if (= (vector-length args) 0)
1
(string->number (vector-ref args 0)))))
(display (fib n))
(newline)))
(main (current-command-line-arguments)))

18
collects/tests/mzscheme/benchmarks/shootout/hash.ss Normal file
View File

@ -0,0 +1,18 @@
(module hash mzscheme
(define (main argv)
(let* ([n (string->number (vector-ref argv 0))]
[hash (make-hash-table 'equal)]
[accum 0]
[false (lambda () #f)])
(let loop ([i 1])
(unless (> i n)
(hash-table-put! hash (number->string i 16) i)
(loop (add1 i))))
(let loop ([i n])
(unless (zero? i)
(when (hash-table-get hash (number->string i) false)
(set! accum (+ accum 1)))
(loop (sub1 i))))
(printf "~s~n" accum)))
(main (current-command-line-arguments)))

25
collects/tests/mzscheme/benchmarks/shootout/hash2.ss Normal file
View File

@ -0,0 +1,25 @@
(module hash2 mzscheme
(define (main argv)
(let* ([n (string->number (vector-ref argv 0))]
[hash1 (make-hash-table 'equal)]
[hash2 (make-hash-table 'equal)]
[zero (lambda () 0)])
(let loop ([i 0])
(unless (= i 10000)
(hash-table-put! hash1 (string-append "foo_" (number->string i)) i)
(loop (add1 i))))
(let loop ([i 0])
(unless (= i n)
(hash-table-for-each hash1 (lambda (key value)
(hash-table-put!
hash2
key
(+ (hash-table-get hash2 key zero) value))))
(loop (add1 i))))
(printf "~s ~s ~s ~s~n"
(hash-table-get hash1 "foo_1")
(hash-table-get hash1 "foo_9999")
(hash-table-get hash2 "foo_1")
(hash-table-get hash2 "foo_9999"))))
(main (current-command-line-arguments)))

74
collects/tests/mzscheme/benchmarks/shootout/heapsort.ss Normal file
View File

@ -0,0 +1,74 @@
;;; heapsort.scm
;; Prints 0.9990640717878372 instead of 0.9990640718 when n=1000.
;; Updated by Justin Smith
;;
;; Updated by Brent Fulgham to provide proper output formatting
(module heapsort mzscheme
(require (only (lib "13.ss" "srfi") string-index string-pad-right))
(define IM 139968)
(define IA 3877)
(define IC 29573)
(define LAST 42)
(define (gen_random max)
(set! LAST (modulo (+ (* LAST IA) IC) IM))
(/ (* max LAST) IM))
(define (heapsort n ra)
(let ((ir n)
(l (+ (quotient n 2) 1))
(i 0)
(j 0)
(rra 0.0))
(let/ec return
(do ((bar #t))
((= 1 0))
(cond ((> l 1)
(set! l (- l 1))
(set! rra (vector-ref ra l)))
(else
(set! rra (vector-ref ra ir))
(vector-set! ra ir (vector-ref ra 1))
(set! ir (- ir 1))
(cond ((<= ir 1)
(vector-set! ra 1 rra)
(return #t)))))
(set! i l)
(set! j (* l 2))
(do ((foo #t))
((> j ir))
(cond ((and (< j ir) (< (vector-ref ra j) (vector-ref ra (+ j 1))))
(set! j (+ j 1))))
(cond ((< rra (vector-ref ra j))
(vector-set! ra i (vector-ref ra j))
(set! i j)
(set! j (+ j i)))
(else
(set! j (+ ir 1)))))
(vector-set! ra i rra)))))
(define (roundto digits num)
(let* ([e (expt 10 digits)]
[num (round (* e (inexact->exact num)))])
(format "~a.~a"
(quotient num e)
(substring (string-append (number->string (remainder num e))
(make-string digits #\0))
0 digits))))
(define (main args)
(let* ((n (or (and (= (vector-length args) 1) (string->number (vector-ref args 0)))
1))
(last (+ n 1))
(ary (make-vector last 0)))
(do ((i 1 (+ i 1)))
((= i last))
(vector-set! ary i (gen_random 1.0)))
(heapsort n ary)
(printf "~a~n"
(roundto 10 (vector-ref ary n)))))
(main (current-command-line-arguments)))

43
collects/tests/mzscheme/benchmarks/shootout/lists.ss Normal file
View File

@ -0,0 +1,43 @@
(module lists mzscheme
(define SIZE 10000)
(define (sequence start stop)
(if (> start stop)
'()
(cons start (sequence (+ start 1) stop))))
(define (head-to-tail! headlist taillist)
(when (null? taillist) (begin
(set! taillist (list (car headlist)))
(set! headlist (cdr headlist))))
(letrec ((htt-helper (lambda (dest)
(when (not (null? headlist))
(let ((headlink headlist))
(set-cdr! dest headlink)
(set! headlist (cdr headlist))
(htt-helper headlink))))))
(htt-helper taillist)
(values headlist taillist)))
(define (test-lists)
(let* ([L1 (sequence 1 SIZE)]
[L2 (append L1 '())]
[L3 '()])
(set!-values (L2 L3) (head-to-tail! L2 L3))
(set!-values (L3 L2) (head-to-tail! (reverse! L3) L2))
(set! L1 (reverse! L1))
(cond ((not (= SIZE (car L1))) 0)
((not (equal? L1 L2)) 0)
(else (length L1)))))
(define (main args)
(let ((result #f))
(let loop ((counter (if (= (vector-length args) 0)
1
(string->number (vector-ref args 0)))))
(when (> counter 0)
(set! result (test-lists))
(loop (- counter 1))))
(printf "~s~n" result)))
(main (current-command-line-arguments)))

80
collects/tests/mzscheme/benchmarks/shootout/mandelbrot.ss Normal file
View File

@ -0,0 +1,80 @@
;; ---------------------------------------------------------------------
;; The Great Computer Language Shootout
;; http://shootout.alioth.debian.org/
;;
;; Derived from the Chicken variant, which was
;; Contributed by Anthony Borla
;; Note: as of version 350, this benchmark spends much of
;; its time GCing; it runs 2 times as fast in mzscheme3m.
;; The version that uses complex number is a little
;; more elegant, but slower:
;; (define (mandelbrot iterations x y n ci)
;; (let ((c (+ (- (/ (* 2.0 x) n) 1.5)
;; (* ci 0.0+1.0i))))
;; (let loop ((i 0) (z 0.0+0.0i))
;; (cond
;; [(> i iterations) 1]
;; [(> (magnitude z) 2.0) 0]
;; [else (loop (add1 i) (+ (* z z) c))]))))
(module mandelbrot mzscheme
;; -------------------------------
(define +limit-sqr+ 4.0)
(define +iterations+ 50)
;; -------------------------------
(define (mandelbrot iterations x y n ci)
(let ((cr (- (/ (* 2.0 x) n) 1.5)))
(let loop ((i 0) (zr 0.0) (zi 0.0))
(if (> i iterations)
1
(let ((zrq (* zr zr))
(ziq (* zi zi)))
(cond
((> (+ zrq ziq) +limit-sqr+) 0)
(else (loop (add1 i) (+ (- zrq ziq) cr) (+ (* 2.0 zr zi) ci)))))))))
;; -------------------------------
(define (main args)
(let ((n (string->number (vector-ref args 0)))
(out (current-output-port)))
(fprintf out "P4\n~a ~a\n" n n)
(let loop-y ((y 0))
(when (< y n)
(let ([ci (- (/ (* 2.0 y) n) 1.0)])
(let loop-x ((x 0) (bitnum 0) (byteacc 0))
(if (< x n)
(let ([bitnum (add1 bitnum)]
[byteacc (+ (arithmetic-shift byteacc 1)
(mandelbrot +iterations+ x y n ci))])
(cond
((= bitnum 8)
(write-byte byteacc out)
(loop-x (add1 x) 0 0))
[else (loop-x (add1 x) bitnum byteacc)]))
(begin
(when (positive? bitnum)
(write-byte (arithmetic-shift byteacc (- 8 (bitwise-and n #x7))) out))
(loop-y (add1 y))))))))))
;; -------------------------------
(main (current-command-line-arguments)))

76
collects/tests/mzscheme/benchmarks/shootout/matrix.ss Normal file
View File

@ -0,0 +1,76 @@
; Matrix.scm
(module matrix mzscheme
(define size 30)
(define (1+ x) (+ x 1))
(define (mkmatrix rows cols)
(let ((mx (make-vector rows 0))
(count 1))
(do ((i 0 (1+ i)))
((= i rows))
(let ((row (make-vector cols 0)))
(do ((j 0 (1+ j)))
((= j cols))
(vector-set! row j count)
(set! count (+ count 1)))
(vector-set! mx i row)))
mx))
(define (num-cols mx)
(let ((row (vector-ref mx 0)))
(vector-length row)))
(define (num-rows mx)
(vector-length mx))
(define (mmult rows cols m1 m2)
(let ((m3 (make-vector rows 0)))
(do ((i 0 (1+ i)))
((= i rows))
(let ((m1i (vector-ref m1 i))
(row (make-vector cols 0)))
(do ((j 0 (1+ j)))
((= j cols))
(let ((val 0))
(do ((k 0 (1+ k)))
((= k cols))
(set! val (+ val (* (vector-ref m1i k)
(vector-ref (vector-ref m2 k) j)))))
(vector-set! row j val)))
(vector-set! m3 i row)))
m3))
(define (matrix-print m)
(do ((i 0 (1+ i)))
((= i (num-rows m)))
(let ((row (vector-ref m i)))
(do ((j 0 (1+ j)))
((= j (num-cols m)))
(display (vector-ref row j))
(if (< j (num-cols m))
(display " ")))
(newline))))
(define (print-list . items) (for-each display items) (newline))
(define (main args)
(let ((n (or (and (= (vector-length args) 1) (string->number (vector-ref
args 0)))
1)))
(let ((mm 0)
(m1 (mkmatrix size size))
(m2 (mkmatrix size size)))
(let loop ((iter n))
(cond ((> iter 0)
(set! mm (mmult size size m1 m2))
(loop (- iter 1)))))
(let ((r0 (vector-ref mm 0))
(r2 (vector-ref mm 2))
(r3 (vector-ref mm 3))
(r4 (vector-ref mm 4)))
(print-list (vector-ref r0 0) " " (vector-ref r2 3) " "
(vector-ref r3 2) " " (vector-ref r4 4))))))
(main (current-command-line-arguments)))

72
collects/tests/mzscheme/benchmarks/shootout/moments.ss Normal file
View File

@ -0,0 +1,72 @@
; Moments.scm
(module moments mzscheme
(require (only (lib "list.ss") sort))
(define (roundto digits n)
(let* ([e (expt 10 digits)]
[num (round (abs (* e (inexact->exact n))))])
(format "~a~a.~a"
(if (negative? n) "-" "")
(quotient num e)
(substring (string-append (number->string (remainder num e))
(make-string digits #\0))
0 digits))))
(let* ((sum 0.0)
(numlist (let loop ((line (read-line)) (numlist '()))
(cond ((eof-object? line) numlist)
(else
(let ((num (string->number line)))
(set! sum (+ num sum))
(loop (read-line) (cons num numlist))))))))
(let ((n (length numlist)))
(let ((mean (/ sum n))
(average_deviation 0.0)
(standard_deviation 0.0)
(variance 0.0)
(skew 0.0)
(kurtosis 0.0)
(median 0.0)
(deviation 0.0))
(let loop ((nums numlist))
(if (not (null? nums))
(begin
(set! deviation (- (car nums) mean))
(set! average_deviation (+ average_deviation (abs deviation)))
(set! variance (+ variance (expt deviation 2.0)))
(set! skew (+ skew (expt deviation 3.0)))
(set! kurtosis (+ kurtosis (expt deviation 4)))
(loop (cdr nums)))))
(set! average_deviation (/ average_deviation (exact->inexact n)))
(set! variance (/ variance (- n 1)))
(set! standard_deviation (sqrt variance))
(cond ((> variance 0.0)
(set! skew (/ skew (* n variance standard_deviation)))
(set! kurtosis (- (/ kurtosis (* n variance variance))
3.0))))
(set! numlist (sort numlist (lambda (x y) (< x y))))
(let ((mid (quotient n 2)))
(if (zero? (modulo n 2))
(set! median (/ (+ (car (list-tail numlist mid))
(car (list-tail numlist (- mid 1))))
2.0))
(set! median (car (list-tail numlist mid)))))
(set! standard_deviation (/ (round (* standard_deviation 1000000))
1000000))
(for-each display
`("n: " ,n "\n"
"median: " ,(roundto 6 median) "\n"
"mean: " ,(roundto 6 mean) "\n"
"average_deviation: " ,(roundto 6 average_deviation ) "\n"
"standard_deviation: " ,(roundto 6 standard_deviation) "\n"
"variance: " ,(roundto 6 variance)"\n"
"skew: " ,(roundto 6 skew) "\n"
"kurtosis: " ,(roundto 6 kurtosis)"\n" ))))))

166
collects/tests/mzscheme/benchmarks/shootout/nbody.ss Normal file
View File

@ -0,0 +1,166 @@
#!/usr/bin/mzscheme -qu
;; The Great Computer Language Shootout
;; http://shootout.alioth.debian.org/
;;
;; Imperative-style implementation based on the SBCL implementation by
;; Patrick Frankenberger and Juho Snellman, but using only native Scheme
;; idioms like 'named let' and 'do' special form.
;;
;; Contributed by Anthony Borla, then converted for mzscheme
;; by Matthew Flatt and Brent Fulgham
#|
Correct output N = 1000 is
-0.169075164
-0.169087605
|#
(module nbody mzscheme
(provide main)
;;; Stupid boiler-plate for formatting floating point value
(define (roundto digits n)
(let* ([e (expt 10 digits)]
[num (round (abs (* e (inexact->exact n))))])
(format "~a~a.~a"
(if (negative? n) "-" "")
(quotient num e)
(substring (string-append (number->string (remainder num e))
(make-string digits #\0))
0 digits))))
;; ------------------------------
;; define planetary masses, initial positions & velocity
(define +pi+ 3.141592653589793)
(define +days-per-year+ 365.24)
(define +solar-mass+ (* 4 +pi+ +pi+))
(define-struct body (x y z vx vy vz mass))
(define *sun*
(make-body 0.0 0.0 0.0 0.0 0.0 0.0 +solar-mass+))
(define *jupiter*
(make-body 4.84143144246472090
-1.16032004402742839
-1.03622044471123109e-1
(* 1.66007664274403694e-3 +days-per-year+)
(* 7.69901118419740425e-3 +days-per-year+)
(* -6.90460016972063023e-5 +days-per-year+)
(* 9.54791938424326609e-4 +solar-mass+)))
(define *saturn*
(make-body 8.34336671824457987
4.12479856412430479
-4.03523417114321381e-1
(* -2.76742510726862411e-3 +days-per-year+)
(* 4.99852801234917238e-3 +days-per-year+)
(* 2.30417297573763929e-5 +days-per-year+)
(* 2.85885980666130812e-4 +solar-mass+)))
(define *uranus*
(make-body 1.28943695621391310e1
-1.51111514016986312e1
-2.23307578892655734e-1
(* 2.96460137564761618e-03 +days-per-year+)
(* 2.37847173959480950e-03 +days-per-year+)
(* -2.96589568540237556e-05 +days-per-year+)
(* 4.36624404335156298e-05 +solar-mass+)))
(define *neptune*
(make-body 1.53796971148509165e+01
-2.59193146099879641e+01
1.79258772950371181e-01
(* 2.68067772490389322e-03 +days-per-year+)
(* 1.62824170038242295e-03 +days-per-year+)
(* -9.51592254519715870e-05 +days-per-year+)
(* 5.15138902046611451e-05 +solar-mass+)))
;; -------------------------------
(define (offset-momentum system)
(let loop-i ((i system) (px 0.0) (py 0.0) (pz 0.0))
(if (null? i)
(begin
(set-body-vx! (car system) (/ (- px) +solar-mass+))
(set-body-vy! (car system) (/ (- py) +solar-mass+))
(set-body-vz! (car system) (/ (- pz) +solar-mass+)))
(loop-i (cdr i)
(+ px (* (body-vx (car i)) (body-mass (car i))))
(+ py (* (body-vy (car i)) (body-mass (car i))))
(+ pz (* (body-vz (car i)) (body-mass (car i))))))))
;; -------------------------------
(define (energy system)
(let loop-o ((o system) (e 0.0))
(if (null? o)
e
(let ([e (+ e (* 0.5 (body-mass (car o))
(+ (* (body-vx (car o)) (body-vx (car o)))
(* (body-vy (car o)) (body-vy (car o)))
(* (body-vz (car o)) (body-vz (car o))))))])
(let loop-i ((i (cdr o)) (e e))
(if (null? i)
(loop-o (cdr o) e)
(let* ((dx (- (body-x (car o)) (body-x (car i))))
(dy (- (body-y (car o)) (body-y (car i))))
(dz (- (body-z (car o)) (body-z (car i))))
(distance (sqrt (+ (* dx dx) (* dy dy) (* dz dz)))))
(let ([e (- e (/ (* (body-mass (car o)) (body-mass (car i))) distance))])
(loop-i (cdr i) e)))))))))
;; -------------------------------
(define (advance system dt)
(let loop-o ((o system))
(unless (null? o)
(let loop-i ((i (cdr o)))
(unless (null? i)
(let* ((o1 (car o))
(i1 (car i))
(dx (- (body-x o1) (body-x i1)))
(dy (- (body-y o1) (body-y i1)))
(dz (- (body-z o1) (body-z i1)))
(distance (sqrt (+ (* dx dx) (* dy dy) (* dz dz))))
(mag (/ dt (* distance distance distance)))
(dxmag (* dx mag))
(dymag (* dy mag))
(dzmag (* dz mag))
(om (body-mass o1))
(im (body-mass i1)))
(set-body-vx! o1 (- (body-vx o1) (* dxmag im)))
(set-body-vy! o1 (- (body-vy o1) (* dymag im)))
(set-body-vz! o1 (- (body-vz o1) (* dzmag im)))
(set-body-vx! i1 (+ (body-vx i1) (* dxmag om)))
(set-body-vy! i1 (+ (body-vy i1) (* dymag om)))
(set-body-vz! i1 (+ (body-vz i1) (* dzmag om)))
(loop-i (cdr i)))))
(loop-o (cdr o))))
(let loop-o ((o system))
(unless (null? o)
(let ([o1 (car o)])
(set-body-x! o1 (+ (body-x o1) (* dt (body-vx o1))))
(set-body-y! o1 (+ (body-y o1) (* dt (body-vy o1))))
(set-body-z! o1 (+ (body-z o1) (* dt (body-vz o1))))
(loop-o (cdr o))))))
;; -------------------------------
(define (main args)
(let ((n (if (null? args)
1
(string->number (car args))))
(system (list *sun* *jupiter* *saturn* *uranus* *neptune*)))
(offset-momentum system)
(printf "~a~%" (roundto 9 (energy system)))
(do ((i 1 (+ i 1)))
((< n i))
(advance system 0.01))
(printf "~a~%" (roundto 9 (energy system)))))
(main (vector->list (current-command-line-arguments))))

18
collects/tests/mzscheme/benchmarks/shootout/nestedloop.ss Normal file
View File

@ -0,0 +1,18 @@
(module nestedloop mzscheme
(require (lib "defmacro.ss"))
(define-macro (nest n expr)
(if (> n 0)
`(let loop ([i 1]) (unless (> i n)
(nest ,(- n 1) ,expr)
(loop (add1 i))))
expr))
(define (main argv)
(let* ([n (string->number (vector-ref argv 0))]
[x 0])
(nest 6 (set! x (+ x 1)))
(printf "~s~n" x)))
(main (current-command-line-arguments)))

50
collects/tests/mzscheme/benchmarks/shootout/nsieve.ss Normal file
View File

@ -0,0 +1,50 @@
#!/usr/bin/mzscheme -qu
;; $Id: nsieve-mzscheme.code,v 1.6 2006/06/10 23:38:29 bfulgham Exp $
;; The Great Computer Language Shootout
;; http://shootout.alioth.debian.org/
;;
;; nsieve benchmark for The Computer Language Shootout
;; Written by Dima Dorfman, 2004
;; Converted to MzScheme by Brent Fulgham
(module nseive mzscheme
(require (only (lib "13.ss" "srfi") string-index string-pad))
(define (nsieve m)
(let ((a (make-vector m #t)))
(let loop ((i 2) (n 0))
(if (< i m)
(begin
(if (vector-ref a i)
(begin
(let clear ((j (+ i i)))
(if (< j m)
(begin
(vector-set! a j #f)
(clear (+ j i)))))
(loop (+ 1 i) (+ 1 n)))
(loop (+ 1 i) n)))
n))))
(define (test n)
(let* ((m (* (expt 2 n) 10000))
(count (nsieve m)))
(printf "Primes up to ~a ~a~%"
(string-pad (number->string m) 8)
(string-pad (number->string count) 8))))
(define (main args)
(if (< (vector-length args) 1)
(begin
(display "An argument is required") (newline) 2)
(let ((n (string->number (vector-ref args 0))))
(if (not n)
(begin
(display "An integer is required") (newline) 2)
(begin
(if (>= n 0) (test n))
(if (>= n 1) (test (- n 1)))
(if (>= n 2) (test (- n 2)))
0)))))
(main (current-command-line-arguments)))

66
collects/tests/mzscheme/benchmarks/shootout/nsievebits.ss Normal file
View File

@ -0,0 +1,66 @@
#!/usr/bin/mzscheme -qu
;;; The Great Computer Language Shootout
;;; http://shootout.alioth.debian.org/
;;
;; Adapted from CMUCL code by Dima Dorfman; bit-vector stuff by Alex Shinn;
;; cobbled together by felix, converted to MzScheme by Brent Fulgham
;; Note: Requires MzScheme 299+
(module nsievebits mzscheme
(define (make-bit-vector size)
(let* ((len (quotient (+ size 7) 8))
(res (make-bytes len #b11111111)))
(let ((off (remainder size 8)))
(unless (zero? off)
(bytes-set! res (- len 1) (- (arithmetic-shift 1 off) 1))))
res))
(define (bit-vector-ref vec i)
(let ((byte (arithmetic-shift i -3))
(off (bitwise-and i #x7)))
(and (< byte (bytes-length vec))
(not (zero? (bitwise-and (bytes-ref vec byte)
(arithmetic-shift 1 off)))))))
(define (bit-vector-set! vec i x)
(let ((byte (arithmetic-shift i -3))
(off (bitwise-and i #x7)))
(let ((val (bytes-ref vec byte))
(mask (arithmetic-shift 1 off)))
(bytes-set! vec
byte
(if x
(bitwise-ior val mask)
(bitwise-and val (bitwise-not mask)))))))
(define (nsievebits m)
(let ((a (make-bit-vector m)))
(define (clear i)
(do ([j (+ i i) (+ j i)])
((>= j m))
(bit-vector-set! a j #f) ) )
(let ([c 0])
(do ([i 2 (add1 i)])
((>= i m) c)
(when (bit-vector-ref a i)
(clear i)
(set! c (add1 c)) ) ) ) ) )
(define (string-pad s n)
(string-append (make-string (- n (string-length s)) #\space)
s))
(define (test n)
(let ((m (* 10000 (arithmetic-shift 1 n))))
(printf "Primes up to ~a ~a~%"
(string-pad (number->string m) 8)
(string-pad (number->string (nsievebits m)) 8))))
(define (main args)
(let ([n (string->number (vector-ref args 0))])
(when (>= n 0) (test n))
(when (>= n 1) (test (- n 1)))
(when (>= n 2) (test (- n 2)))))
(main (current-command-line-arguments)))

70
collects/tests/mzscheme/benchmarks/shootout/partialsums.ss Normal file
View File

@ -0,0 +1,70 @@
;; ---------------------------------------------------------------------
;; The Great Computer Language Shootout
;; http://shootout.alioth.debian.org/
;;
;; Based on D language implementation by Dave Fladebo [imperative version]
;;
;; Derived from the Chicken variant, which was
;; Contributed by Anthony Borla
;; ---------------------------------------------------------------------
;; Note: as of version 350, this benchmark spends much of
;; its time GCing; it runs 1.5 times as fast in mzscheme3m.
(module partialsums mzscheme
(define (roundto digits n)
(let* ([e (expt 10 digits)]
[num (round (abs (* e (inexact->exact n))))])
(format "~a~a.~a"
(if (negative? n) "-" "")
(quotient num e)
(substring (string-append (number->string (remainder num e))
(make-string digits #\0))
0 digits))))
(let ((n (exact->inexact
(string->number
(vector-ref (current-command-line-arguments) 0))))
(alt 1) (d2 0) (d3 0) (ds 0) (dc 0)
(s0 0) (s1 0) (s2 0) (s3 0) (s4 0) (s5 0) (s6 0) (s7 0) (s8 0))
(let loop ([d 0.0]
(alt 1) (d2 0) (d3 0) (ds 0) (dc 0)
(s0 0) (s1 0) (s2 0) (s3 0) (s4 0) (s5 0) (s6 0) (s7 0) (s8 0))
(if (= d n #;(+ n 1))
(let ([format-result
(lambda (str n)
(printf str (roundto 9 n)))])
(format-result "~a\t(2/3)^k\n" s0)
(format-result "~a\tk^-0.5\n" s1)
(format-result "~a\t1/k(k+1)\n" s2)
(format-result "~a\tFlint Hills\n" s3)
(format-result "~a\tCookson Hills\n" s4)
(format-result "~a\tHarmonic\n" s5)
(format-result "~a\tRiemann Zeta\n" s6)
(format-result "~a\tAlternating Harmonic\n" s7)
(format-result "~a\tGregory\n" s8))
(let* ((d (+ d 1))
(d2 (* d d))
(d3 (* d2 d))
(ds (sin d))
(dc (cos d))
(s0 (+ s0 (expt (/ 2.0 3) (- d 1))))
(s1 (+ s1 (/ 1 (sqrt d))))
(s2 (+ s2 (/ 1 (* d (+ d 1)))))
(s3 (+ s3 (/ 1 (* d3 (* ds ds)))))
(s4 (+ s4 (/ 1 (* d3 (* dc dc)))))
(s5 (+ s5 (/ 1 d)))
(s6 (+ s6 (/ 1 d2)))
(s7 (+ s7 (/ alt d)))
(s8 (+ s8 (/ alt (- (* 2 d) 1))))
(alt (- alt)))
(loop d
alt d2 d3 ds dc
s0 s1 s2 s3 s4 s5 s6 s7 s8))))))

46
collects/tests/mzscheme/benchmarks/shootout/pidigits.ss Normal file
View File

@ -0,0 +1,46 @@
;; The Computer Language Shootout
;; http://shootout.alioth.debian.org/
;; Based on the MLton version of the benchmark
;; contributed by Scott Cruzen
;; Note: as of version 350, this benchmark spends most of
;; its time GCing; it runs 3 times as fast in mzscheme3m.
(module pidigits mzscheme
(define (floor_ev q r s t x)
(quotient (+ (* q x) r) (+ (* s x) t)))
(define (comp q r s t q2 r2 s2 t2)
(values (+ (* q q2) (* r s2))
(+ (* q r2) (* r t2))
(+ (* s q2) (* t s2))
(+ (* s r2) (* t t2))))
(define (next q r s t) (floor_ev q r s t 3))
(define (safe? q r s t n) (= n (floor_ev q r s t 4)))
(define (prod q r s t n) (comp 10 (* -10 n) 0 1 q r s t))
(define (mk q r s t k) (comp q r s t k (* 2 (add1 (* 2 k))) 0 (add1 (* 2 k))))
(define (digit k q r s t n row col)
(if (> n 0)
(let ([y (next q r s t)])
(if (safe? q r s t y)
(let-values ([(q r s t) (prod q r s t y)])
(if (= col 10)
(let ([row (+ row 10)])
(printf "\t:~a\n~a" row y)
(digit k q r s t (sub1 n) row 1))
(begin
(printf "~a" y)
(digit k q r s t(sub1 n) row (add1 col)))))
(let-values ([(q r s t) (mk q r s t k)])
(digit (add1 k) q r s t n row col))))
(printf "~a\t:~a\n"
(make-string (- 10 col) #\space)
(+ row col))))
(define (digits n)
(digit 1 1 0 0 1 n 0 0))
(digits (string->number (vector-ref (current-command-line-arguments) 0))))

57
collects/tests/mzscheme/benchmarks/shootout/pidigits1.ss Normal file
View File

@ -0,0 +1,57 @@
#!/usr/bin/mzscheme -r
; The Computer Language Shootout
; http://shootout.alioth.debian.org/
; Sven Hartrumpf 2005-04-12
; Implements 'Spigot' algorithm origionally due to Stanly Rabinowitz.
; This program is based on an implementation for SCM by Aubrey Jaffer and
; Jerry D. Hedden.
(module pidigits1 mzscheme
(define (pi n d)
(let* ((r (inexact->exact (floor (exp (* d (log 10)))))) ; 10^d
(p (+ (quotient n d) 1))
(m (quotient (* p d 3322) 1000))
(a (make-vector (+ m 1) 2))
(out (current-output-port)))
(vector-set! a m 4)
(let j-loop ([b 2][digits 0])
(if (= digits n)
;; Add whitespace for ungenerated digits
(let ([left (modulo digits 10)])
(unless (zero? left)
(fprintf out "~a\t:~a\n" (make-string (- 10 left) #\space) n)))
;; Compute more digits
(let loop ([k m][q 0])
(if (zero? k)
(let* ((s (let ([s (number->string (+ b (quotient q r)))])
(if (zero? digits)
s
(string-append (make-string (- d (string-length s)) #\0) s)))))
(j-loop (remainder q r)
(print-digits out s 0 (string-length s) digits n)))
(let ([q (+ q (* (vector-ref a k) r))])
(let ((t (+ (* k 2) 1)))
(let-values ([(qt rr) (quotient/remainder q t)])
(vector-set! a k rr)
(loop (sub1 k) (* k qt)))))))))))
(define (print-digits out s start end digits n)
(let* ([len (- end start)]
[cnt (min len (- n digits) (- 10 (modulo digits 10)) len)])
(if (zero? cnt)
digits
(begin
(write-string s out start (+ start cnt))
(let ([digits (+ digits cnt)])
(when (zero? (modulo digits 10))
(fprintf out "\t:~a\n" digits))
(print-digits out s (+ start cnt) end digits n))))))
(define (main args)
(let ((n (if (= (vector-length args) 0)
1
(string->number (vector-ref args 0)))))
(pi n 10)))
(main (current-command-line-arguments)))

40
collects/tests/mzscheme/benchmarks/shootout/random.ss Normal file
View File

@ -0,0 +1,40 @@
;;; http://shootout.alioth.debian.org/
;;; Random implementation, by Jens Axel Sogaard
;;;
;;; Modified for proper string output by Brent Fulgham
(module random mzscheme
(provide main)
(define IM 139968)
(define IA 3877)
(define IC 29573)
(define gen_random
(let ((LAST 42))
(lambda (max)
(set! LAST (modulo (+ (* LAST IA) IC) IM))
(/ (* max LAST) IM))))
(define (roundto digits num)
(let* ([e (expt 10 digits)]
[num (round (* e (inexact->exact num)))])
(format "~a.~a"
(quotient num e)
(substring (string-append (number->string (remainder num e))
(make-string digits #\0))
0 digits))))
(define (main args)
(let ((n (if (= (vector-length args) 0)
1
(string->number (vector-ref args 0)))))
(let loop ((iter n))
(if (> iter 1)
(begin
(gen_random 100.0)
(loop (- iter 1)))))
(printf "~a~%"
(roundto 9 (gen_random 100.0)))))
(main (current-command-line-arguments)))

65
collects/tests/mzscheme/benchmarks/shootout/recursive.ss Normal file
View File

@ -0,0 +1,65 @@
;; ---------------------------------------------------------------------
;; The Great Computer Language Shootout
;; http://shootout.alioth.debian.org/
;;
;; Code based on / inspired by existing, relevant Shootout submissions
;;
;; Derived from the Chicken variant, which was
;; Contributed by Anthony Borla
;; ---------------------------------------------------------------------
(module recursive mzscheme
;; -------------------------------
(define (ack m n)
(cond ((zero? m) (+ n 1))
((zero? n) (ack (- m 1) 1))
(else (ack (- m 1) (ack m (- n 1))))))
;; --------------
(define (fib n)
(cond ((< n 2) 1)
(else (+ (fib (- n 2)) (fib (- n 1))))))
(define (fibflt n)
(cond ((< n 2.0) 1.0)
(else (+ (fibflt (- n 2.0)) (fibflt (- n 1.0))))))
;; --------------
(define (tak x y z)
(cond ((not (< y x)) z)
(else (tak (tak (- x 1) y z) (tak (- y 1) z x) (tak (- z 1) x y)))))
(define (takflt x y z)
(cond ((not (< y x)) z)
(else (takflt (takflt (- x 1.0) y z) (takflt (- y 1.0) z x) (takflt (- z 1.0) x y)))))
;; -------------------------------
(define (roundto digits n)
(let* ([e (expt 10 digits)]
[num (round (* e (inexact->exact n)))])
(format "~a.~a"
(quotient num e)
(substring (string-append (number->string (remainder num e))
(make-string digits #\0))
0 digits))))
(define (main args)
(let ((n (string->number (vector-ref args 0))))
(printf "Ack(3,~A): ~A~%" n (ack 3 n))
(printf "Fib(~a): ~a~%" (roundto 1 (+ 27.0 n)) (roundto 1 (fibflt (+ 27.0 n))))
(set! n (- n 1))
(printf "Tak(~A,~A,~A): ~A~%" (* n 3) (* n 2) n (tak (* n 3) (* n 2) n))
(printf "Fib(3): ~A~%" (fib 3))
(printf "Tak(3.0,2.0,1.0): ~a~%" (roundto 1 (takflt 3.0 2.0 1.0)))))
;; -------------------------------
(main (current-command-line-arguments)))

59
collects/tests/mzscheme/benchmarks/shootout/regexmatch.ss Normal file
View File

@ -0,0 +1,59 @@
;; $Id: regexmatch-mzscheme.code,v 1.9 2006/06/21 15:05:29 bfulgham Exp $
;;; http://shootout.alioth.debian.org/
;;;
;;; Based on the Chicken implementation
;;; Contributed by Brent Fulgham
;; Uses byte regexps instead of string regexps for a fairer comparison
;; NOTE: the running time of this benchmark is dominated by
;; construction of the `num' string.
(module regexmatch mzscheme
(define rx
(string-append
"(?:^|[^0-9\\(])" ; (1) preceeding non-digit or bol
"(" ; (2) area code
"\\(([0-9][0-9][0-9])\\)" ; (3) is either 3 digits in parens
"|" ; or
"([0-9][0-9][0-9])" ; (4) just 3 digits
")" ; end of area code
" " ; area code is followed by one space
"([0-9][0-9][0-9])" ; (5) exchange is 3 digits
"[ -]" ; separator is either space or dash
"([0-9][0-9][0-9][0-9])" ; (6) last 4 digits
"(?:[^0-9]|$)" ; must be followed by a non-digit
))
(define (main args)
(let ((n (if (= (vector-length args) 0)
"1"
(vector-ref args 0)))
(phonelines '())
(rx (byte-regexp (string->bytes/utf-8 rx)))
(count 0))
(let loop ((line (read-bytes-line)))
(cond ((eof-object? line) #f)
(else
(set! phonelines (cons line phonelines))
(loop (read-line)))))
(set! phonelines (reverse! phonelines))
(do ([n (string->number n) (sub1 n)])
((negative? n))
(let loop ((phones phonelines)
(count 0))
(if (null? phones)
count
(let ([m (regexp-match rx (car phones))])
(if m
(let-values ([(a1 a2 a3 exch numb) (apply values (cdr m))])
(let* ([area (and a1 (or a2 a3))]
[num (bytes-append #"(" area #") " exch #"-" numb)]
[count (add1 count)])
(when (zero? n)
(printf "~a: ~a~n" count num))
(loop (cdr phones) count)))
(loop (cdr phones) count))))))))
(main (current-command-line-arguments)))

105
collects/tests/mzscheme/benchmarks/shootout/regexpdna.ss Normal file
View File

@ -0,0 +1,105 @@
;; ---------------------------------------------------------------------
;; The Great Computer Language Shootout
;; http://shootout.alioth.debian.org/
;;
;; Tested with PCRE [compiler must be built with PCRE already installed
;; else other regex routines (with different behaviours) will be used].
;; Regex performance appears reasonable, but file loading [of 'large'
;; files] performance requires tweaking to effect a significant improvement.
;;
;; Contributed by Anthony Borla
;; ---------------------------------------------------------------------
(module regexpdna mzscheme
(require (lib "port.ss"))
;; -------------------------------
(define VARIANTS
'(#"agggtaaa|tttaccct" #"[cgt]gggtaaa|tttaccc[acg]" #"a[act]ggtaaa|tttacc[agt]t"
#"ag[act]gtaaa|tttac[agt]ct" #"agg[act]taaa|ttta[agt]cct" #"aggg[acg]aaa|ttt[cgt]ccct"
#"agggt[cgt]aa|tt[acg]accct" #"agggta[cgt]a|t[acg]taccct" #"agggtaa[cgt]|[acg]ttaccct"))
(define IUBS
'((#"B" #"(c|g|t)") (#"D" #"(a|g|t)") (#"H" #"(a|c|t)")
(#"K" #"(g|t)") (#"M" #"(a|c)") (#"N" #"(a|c|g|t)")
(#"R" #"(a|g)") (#"S" #"(c|g)") (#"V" #"(a|c|g)")
(#"W" #"(a|t)") (#"Y" #"(c|t)")))
;; -------------------------------
(define (ci-byte-regexp s)
(byte-regexp (ci-pattern s)))
(define (ci-pattern s)
(let ([m (regexp-match #rx#"^(.*)\\[([^]]*)\\](.*)$" s)])
(if m
(bytes-append (ci-pattern (cadr m))
#"["
(regexp-replace* #rx#"[a-zA-Z]" (caddr m) both-cases)
#"]"
(ci-pattern (cadddr m)))
(regexp-replace* #rx#"[a-zA-Z]" s (lambda (s)
(string->bytes/latin-1
(format "[~a]" (both-cases s))))))))
(define (both-cases s)
(string->bytes/latin-1
(format "~a~a"
(string-downcase (bytes->string/latin-1 s))
(string-upcase (bytes->string/latin-1 s)))))
;; -------------------------------
(define (match-count str rx offset cnt)
(let ([m (regexp-match-positions rx str offset)])
(if m
(match-count str rx (cdar m) (add1 cnt))
cnt)))
;; --------------
(define (replace-all rx str new)
(let ([out (open-output-bytes)])
(let loop ([pos 0])
(let ([m (regexp-match-positions rx str pos)])
(if m
(begin
(write-bytes str out pos (caar m))
(write-bytes new out)
(loop (cdar m)))
(write-bytes str out pos))))
(get-output-bytes out)))
;; -------------------------------
(define (input->bytes)
(let ([b (open-output-bytes)])
(copy-port (current-input-port) b)
(get-output-bytes b)))
;; -------------------------------
;; Load sequence and record its length
(let* ([orig (input->bytes)]
[filtered (replace-all #rx#"(>.*?\n)|\n" orig #"")])
;; Perform regexp counts
(for-each
(lambda (i)
(printf "~a ~a\n" i (match-count filtered (ci-byte-regexp i) 0 0)))
VARIANTS)
;; Perform regexp replacements, and record sequence length
(let ([replaced
(let loop ([sequence filtered]
[IUBS IUBS])
(if (null? IUBS)
sequence
(loop (replace-all (byte-regexp (caar IUBS)) sequence (cadar IUBS))
(cdr IUBS))))])
;; Print statistics
(printf "~%~A~%~A~%~A~%"
(bytes-length orig)
(bytes-length filtered)
(bytes-length replaced)))))

60
collects/tests/mzscheme/benchmarks/shootout/reversecomplement.ss Normal file
View File

@ -0,0 +1,60 @@
(module reversecomplement mzscheme
(define translation (make-vector 128))
(for-each (lambda (from-to)
(let ([char (lambda (sym)
(string-ref (symbol->string sym) 0))])
(let ([from (char (car from-to))]
[to (char->integer (char-upcase (char (cadr from-to))))])
(vector-set! translation (char->integer from) to)
(vector-set! translation (char->integer (char-upcase from)) to))))
'([a t]
[c g]
[g c]
[t a]
[u a]
[m k]
[r y]
[w w]
[s s]
[y R]
[k M]
[v b]
[h d]
[d h]
[b v]
[n n]))
(define (output lines)
(let* ([str (apply bytes-append lines)]
[o (current-output-port)]
[len (bytes-length str)])
(let loop ([offset 0])
(when (< offset len)
(write-bytes str o offset (min len (+ offset 60)))
(newline o)
(loop (+ offset 60))))))
(let ([in (current-input-port)])
(let loop ([accum null])
(let ([l (read-bytes-line in)])
(if (eof-object? l)
(output accum)
(cond
[(regexp-match #rx#"^>" l)
(output accum)
(printf "~a\n" l)
(loop null)]
[else
(let* ([len (bytes-length l)]
[dest (make-bytes len)])
(let loop ([i 0][j (- len 1)])
(unless (= i len)
(bytes-set! dest
j
(vector-ref translation (bytes-ref l i)))
(loop (add1 i) (sub1 j))))
(loop (cons dest accum)))]))))))

13
collects/tests/mzscheme/benchmarks/shootout/reversefile.ss Normal file
View File

@ -0,0 +1,13 @@
;;; -*- mode: scheme -*-
;;; $Id: reversefile-mzscheme.code,v 1.10 2006/06/21 15:05:29 bfulgham Exp $
;;; http://shootout.alioth.debian.org/
;;; Provided by Bengt Kleberg
(module reversefile mzscheme
(let ([inport (current-input-port)])
(let rev ([lines null])
(let ([line (read-bytes-line inport)])
(if (eof-object? line)
(for-each (lambda (l) (printf "~a\n" l))
lines)
(rev (cons line lines)))))))

54
collects/tests/mzscheme/benchmarks/shootout/run.ss Normal file
View File

@ -0,0 +1,54 @@
(module run mzscheme
(define input-map
'(
("ackermann.ss" . "11")
("ary.ss" . "9000")
("binarytrees.ss" . "16")
("chameneos.ss")
("cheapconcurrency.ss")
("echo.ss" . "150000")
("except.ss" . "2500000")
("fannkuch.ss")
("fasta.ss")
("fibo.ss" . "32")
("hash.ss" . "100000")
("hash2.ss" . "200")
("heapsort.ss" . "100000")
("lists.ss" . "18")
("mandelbrot.ss")
("matrix.ss" . "600")
("moments.ss" . "200")
("nbody.ss")
("nestedloop.ss" . "18")
("nsieve.ss")
("nsievebits.ss")
("partialsums.ss")
("pidigits.ss")
("pidigits1.ss")
("random.ss" . "900000")
("recursive.ss")
("regexmatch.ss")
("regexpdna.ss")
("reversecomplement.ss")
("reversefile.ss")
("sieve.ss" . "1200")
("spellcheck.ss")
("strcat.ss" . "40000")
("sumcol.ss")
("wc.ss")
("wordfreq.ss")
))
(let ([len (vector-length (current-command-line-arguments))])
(unless (= 1 len)
(error 'run "provide ~athe name of a benchmark on the command line"
(if (zero? len) "" "ONLY "))))
(let ([prog (vector-ref (current-command-line-arguments) 0)])
(let ([m (assoc prog input-map)])
(unless m
(error 'run "cannot find input for ~a" prog))
(when (null? (cdr m))
(error 'run "don't know input for ~a" prog))
(parameterize ([current-command-line-arguments (vector (cdr m))])
(time (dynamic-require prog #f))))))

25
collects/tests/mzscheme/benchmarks/shootout/sieve.ss Normal file
View File

@ -0,0 +1,25 @@
(module sieve mzscheme
(define (main args)
(let ((n (if (= (vector-length args) 0)
1
(string->number (vector-ref args 0))))
(count 0)
(flags (make-vector 8192)))
(let loop ((iter n))
(if (> iter 0)
(begin
(do ((i 0 (+ i 1))) ((>= i 8192)) (vector-set! flags i #t))
(set! count 0)
(do ((i 2 (+ 1 i)))
((>= i 8192))
(if (vector-ref flags i)
(begin
(do ((k (+ i i) (+ k i)))
((>= k 8192))
(vector-set! flags k #f))
(set! count (+ 1 count)))))
(loop (- iter 1)))))
(display "Count: ") (display count) (newline)))
(main (current-command-line-arguments)))

23
collects/tests/mzscheme/benchmarks/shootout/spellcheck.ss Normal file
View File

@ -0,0 +1,23 @@
;;; The Great Computer Language Shootout
;;; http://shootout.alioth.debian.org/
;;;
;;; spellcheck benchmark
(module spellcheck mzscheme
(define dict (make-hash-table 'equal))
(with-input-from-file "Usr.Dict.Words"
(lambda ()
(let loop ()
(let ([r (read-bytes-line)])
(unless (eof-object? r)
(hash-table-put! dict r #t)
(loop))))))
(let ([in (current-input-port)])
(let loop ()
(let ([w (read-bytes-line in)])
(unless (eof-object? w)
(unless (hash-table-get dict w (lambda () #f))
(printf "~a\n" w))
(loop))))))

35
collects/tests/mzscheme/benchmarks/shootout/strcat.ss Normal file
View File

@ -0,0 +1,35 @@
; strcat.scm
;;; SPECIFICATION
;For this test, each program should be implemented in the same way,
;according to the following specification.
;
; pseudocode for strcat test
;
; s is initialized to the null string
; repeat N times:
; append "hello\n" to s
; count the number of individual characters in s
; print the count
; There should be N distinct string append statements done in a loop.
; After each append the resultant string should be 6 characters
; longer (the length of "hello\n").
; s should be a string, string buffer, or character array.
; The program should not construct a list of strings and join it.
(module strcat mzscheme
(define p (open-output-bytes))
(define hello #"hello\n")
(let loop ([n (string->number
(vector-ref (current-command-line-arguments) 0))])
(unless (zero? n)
(display hello p)
;; At this point, (get-output-bytes p) would
;; return the byte string accumulated so far.
(loop (sub1 n))))
(printf "~a\n" (file-position p)))

10
collects/tests/mzscheme/benchmarks/shootout/sumcol.ss Normal file
View File

@ -0,0 +1,10 @@
;;; http://shootout.alioth.debian.org/
;;;
;;; Contributed by Eli Barzilay
(module sumcol mzscheme
(let loop ([acc 0])
(let ([n (read)])
(if (eof-object? n)
(printf "~a\n" acc)
(loop (+ acc n))))))

18
collects/tests/mzscheme/benchmarks/shootout/wc.ss Normal file
View File

@ -0,0 +1,18 @@
;
; Faster, more idiomatic Scheme by Neil Van Dyke
;
(module wc mzscheme
(define (main iport)
(apply printf "~s ~s ~s\n"
(let wc ((i #f) (lines 0) (words 0) (chars 0))
(let ((x (read-char iport)))
(if (eof-object? x)
(list lines words chars)
(case x
((#\newline) (wc #f (add1 lines) words (add1 chars)))
((#\space #\tab) (wc #f lines words (add1 chars)))
(else
(wc #t lines (if i words (add1 words)) (add1 chars)))))))))
(main (current-input-port)))

32
collects/tests/mzscheme/benchmarks/shootout/wordfreq.ss Normal file
View File

@ -0,0 +1,32 @@
; $Id: wordfreq-mzscheme.code,v 1.10 2006/06/21 15:05:34 bfulgham Exp $
; http://shootout.alioth.debian.org/
; wordfreq.mzscheme by Grzegorz Chrupaa
; Updated and corrected by Brent Fulgham
; Re-written by Matthew Flatt with some inspriation from the Python example
(module wordfreq mzscheme
(require (lib "list.ss"))
(define t (make-hash-table 'equal))
(define (register-word! s)
(let ([s (string-downcase (bytes->string/utf-8 s))])
(hash-table-put! t s (add1 (hash-table-get t s (lambda () 0))))))
(let ([in (current-input-port)])
(let loop ()
(let ([m (regexp-match #rx#"[a-zA-Z]+" in)])
(when m
(register-word! (car m))
(loop)))))
(for-each display
(sort (hash-table-map
t
(lambda (word count)
(let ((count (number->string count)))
(format"~a~a ~a~%"
(make-string (- 7 (string-length count)) #\space)
count
word))))
string>?)))