;; The Great Computer Language Shootout ;; http://shootout.alioth.debian.org/ ;; ;; fasta - benchmark ;; ;; Derived from the Chicken variant, which was ;; Contributed by Anthony Borla #lang scheme/base (require scheme/cmdline) (define +alu+ (bytes-append #"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" #"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" #"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" #"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" #"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" #"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" #"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")) (define +iub+ (list '(#\a . 0.27) '(#\c . 0.12) '(#\g . 0.12) '(#\t . 0.27) '(#\B . 0.02) '(#\D . 0.02) '(#\H . 0.02) '(#\K . 0.02) '(#\M . 0.02) '(#\N . 0.02) '(#\R . 0.02) '(#\S . 0.02) '(#\V . 0.02) '(#\W . 0.02) '(#\Y . 0.02))) (define +homosapien+ (list '(#\a . 0.3029549426680) '(#\c . 0.1979883004921) '(#\g . 0.1975473066391) '(#\t . 0.3015094502008))) ;; ------------- (define +line-size+ 60) ;; ------------------------------- (define (make-random seed) (let* ((ia 3877) (ic 29573) (im 139968) (last seed)) (lambda (max) (set! last (modulo (+ ic (* last ia)) im)) (/ (* max last) im) ))) ;; ------------------------------- (define (make-cumulative-table frequency-table) (let ([cumulative 0.0]) (map (lambda (x) (set! cumulative (+ cumulative (cdr x))) (cons (char->integer (car x)) cumulative)) frequency-table))) ;; ------------- (define random-next (make-random 42)) (define +segmarker+ ">") ;; ------------- (define (select-random cumulative-table) (let ((rvalue (random-next 1.0))) (select-over-threshold rvalue cumulative-table))) (define (select-over-threshold rvalue table) (if (<= rvalue (cdar table)) (caar table) (select-over-threshold rvalue (cdr table)))) ;; ------------- (define (repeat-fasta id desc n_ sequence line-length) (let ((seqlen (bytes-length sequence)) (out (current-output-port))) (display (string-append +segmarker+ id " " desc "\n") out) (let loop-o ((n n_) (k 0)) (unless (<= n 0) (let ((m (min n line-length))) (let loop-i ((i 0) (k k)) (if (>= i m) (begin (newline out) (loop-o (- n line-length) k)) (let ([k (if (= k seqlen) 0 k)]) (write-byte (bytes-ref sequence k) out) (loop-i (add1 i) (add1 k)))))))))) ;; ------------- (define (random-fasta id desc n_ cumulative-table line-length) (let ((out (current-output-port))) (display (string-append +segmarker+ id " " desc "\n") out) (let loop-o ((n n_)) (unless (<= n 0) (let ((m (min n line-length))) (let loop-i ((i 0)) (unless (>= i m) (write-byte (select-random cumulative-table) out) (loop-i (add1 i)))) (newline out) (loop-o (- n line-length))))))) ;; ------------------------------- (let ((n (command-line #:args (n) (string->number n)))) (repeat-fasta "ONE" "Homo sapiens alu" (* n 2) +alu+ +line-size+) (random-fasta "TWO" "IUB ambiguity codes" (* n 3) (make-cumulative-table +iub+) +line-size+) (random-fasta "THREE" "Homo sapiens frequency" (* n 5) (make-cumulative-table +homosapien+) +line-size+))