racket/collects/tests/mzscheme/benchmarks/shootout/fasta.ss
2006-07-27 19:32:22 +00:00

120 lines
3.4 KiB
Scheme

;; The Great Computer Language Shootout
;; http://shootout.alioth.debian.org/
;;
;; fasta - benchmark
;;
;; Derived from the Chicken variant, which was
;; Contributed by Anthony Borla
(module fasta mzscheme
(define +alu+
(bytes-append
#"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
#"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
#"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
#"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
#"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"
#"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
#"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"))
(define +iub+
(list
'(#\a . 0.27) '(#\c . 0.12) '(#\g . 0.12) '(#\t . 0.27) '(#\B . 0.02)
'(#\D . 0.02) '(#\H . 0.02) '(#\K . 0.02) '(#\M . 0.02) '(#\N . 0.02)
'(#\R . 0.02) '(#\S . 0.02) '(#\V . 0.02) '(#\W . 0.02) '(#\Y . 0.02)))
(define +homosapien+
(list
'(#\a . 0.3029549426680) '(#\c . 0.1979883004921)
'(#\g . 0.1975473066391) '(#\t . 0.3015094502008)))
;; -------------
(define +line-size+ 60)
;; -------------------------------
(define (make-random seed)
(let* ((ia 3877) (ic 29573) (im 139968) (last seed))
(lambda (max)
(set! last (modulo (+ ic (* last ia)) im))
(/ (* max last) im) )))
;; -------------------------------
(define (make-cumulative-table frequency-table)
(let ((cumulative 0.0))
(map
(lambda (x)
(set! cumulative (+ cumulative (cdr x)))
(cons (char->integer (car x)) cumulative))
frequency-table)))
;; -------------
(define random-next (make-random 42))
(define +segmarker+ ">")
;; -------------
(define (select-random cumulative-table)
(let ((rvalue (random-next 1.0)))
(select-over-threshold rvalue cumulative-table)))
(define (select-over-threshold rvalue table)
(if (<= rvalue (cdar table))
(caar table)
(select-over-threshold rvalue (cdr table))))
;; -------------
(define (repeat-fasta id desc n_ sequence line-length)
(let ((seqlen (bytes-length sequence))
(out (current-output-port)))
(display (string-append +segmarker+ id " " desc "\n") out)
(let loop-o ((n n_) (k 0))
(unless (<= n 0)
(let ((m (min n line-length)))
(let loop-i ((i 0) (k k))
(if (>= i m)
(begin
(newline out)
(loop-o (- n line-length) k))
(let ([k (if (= k seqlen) 0 k)])
(write-byte (bytes-ref sequence k) out)
(loop-i (add1 i) (add1 k))))))))))
;; -------------
(define (random-fasta id desc n_ cumulative-table line-length)
(let ((out (current-output-port)))
(display (string-append +segmarker+ id " " desc "\n") out)
(let loop-o ((n n_))
(unless (<= n 0)
(let ((m (min n line-length)))
(let loop-i ((i 0))
(unless (>= i m)
(write-byte (select-random cumulative-table) out)
(loop-i (add1 i))))
(newline out)
(loop-o (- n line-length)))))))
;; -------------------------------
(define (main args)
(let ((n (string->number (vector-ref args 0))))
(repeat-fasta "ONE" "Homo sapiens alu" (* n 2) +alu+ +line-size+)
(random-fasta "TWO" "IUB ambiguity codes" (* n 3)
(make-cumulative-table +iub+) +line-size+)
(random-fasta "THREE" "Homo sapiens frequency" (* n 5)
(make-cumulative-table +homosapien+) +line-size+) ))
;; -------------------------------
(main (current-command-line-arguments)))